Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1617 bp · LXL04_009564|LXL04_009564|OH1004|cDNA
ATGGCCGCTCGAAGAATCTCCGGCGTCCTCCACCGTTCCTTTTCTATTCGtcctctttcttcttcgatCGTTTCTCGAGGAAAAACATCAAATTTGGACGGTAAATTACGAAGATTTGGTACAGCAGCAGTACTCGAAGAACCAATTACTCCATCTGTTCGAGTCAATTACACTCAGCTTCTAATCGATGGAAAATTCGTCGATTCAGCATCCGGAAAAACATTCCCGACATTGGATCCACGAACAGGGGAAGTCATCGC...
1617 bp · LXL04_009564|LXL04_009564|OH1004|CDS
ATGGCCGCTCGAAGAATCTCCGGCGTCCTCCACCGTTCCTTTTCTATTCGTCCTCTTTCTTCTTCGATCGTTTCTCGAGGAAAAACATCAAATTTGGACGGTAAATTACGAAGATTTGGTACAGCAGCAGTACTCGAAGAACCAATTACTCCATCTGTTCGAGTCAATTACACTCAGCTTCTAATCGATGGAAAATTCGTCGATTCAGCATCCGGAAAAACATTCCCGACATTGGATCCACGAACAGGGGAAGTCATCGC...
Protein
Download Protein FASTA538 aa · LXL04_009564|LXL04_009564|OH1004|PROTEIN
MAARRISGVLHRSFSIRPLSSSIVSRGKTSNLDGKLRRFGTAAVLEEPITPSVRVNYTQLLIDGKFVDSASGKTFPTLDPRTGEVIAHIAEGDAEDINRAVSAARKAFDEGPWPKMTAYERSCILLRFADLIEKHNDDIAALETWDNGKTYEQAAKGEIPMLTRLFRYYAGWADKIHGLTVPADGPYHVQTLHEPIGVCGQIIPWNFPLLMFAWKVGPALACGNTIVLKTAEQTPLTALYVAQLLLEAGLPPGVLNIVSG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_009564 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_009564 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:129056053-129059599 (-) | |||||||||
| Description | Similar to ALDH2B4: Aldehyde dehydrogenase family 2 member B4, mitochondrial | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006067 ethanol metabolic process Biological Process GO:0006068 ethanol catabolic process Biological Process GO:0007623 circadian rhythm Biological Process GO:0010597 green leaf volatile biosynthetic process Biological Process GO:0018937 nitroglycerin metabolic process Biological Process GO:0019752 carboxylic acid metabolic process Biological Process GO:0046185 aldehyde catabolic process Biological Process GO:0110095 cellular detoxification of aldehyde Biological Process GO:1903179 regulation of dopamine biosynthetic process Biological Process GO:1905627 regulation of serotonin biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005739 mitochondrion Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G23800 ath:AT3G48000 bta:508629 ssc:733685 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00171.28Aldedh66-528 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_009564 | PF00171.28 | Aldedh | 66 | 528 | 6.1e-179 | 596.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.