LXL04_009441 | RubberDandelionOmics

Gene overview

LXL04_009441

Reference: OH-1004 Chr: Chr02 Coordinates: 126670757-126672717 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1179 bp · LXL04_009441|LXL04_009441|OH1004|cDNA

ATGAAGCGATTCTTTCAACCAGTGCAGAAAGATGCGTCTTTCAAGAAACCAACACTCTCTTCTACTTCTTCCCCAGCCAACGATACCCAAACAGAAACATCAACAGCAACACCGGTCGAAGATGACGGAAAACACACCCAAAAGAAACAACCCACAAAGTTCTTGACTTGGAATGCAAACAGCTTCCTTCTCCGGGTTAAAAACAACTGGCCGGAGTTCACCAAGCTTATCGACTCCATTGATCCTGATGTTATAGCCAT...

CDS

Download CDS FASTA

1179 bp · LXL04_009441|LXL04_009441|OH1004|CDS

ATGAAGCGATTCTTTCAACCAGTGCAGAAAGATGCGTCTTTCAAGAAACCAACACTCTCTTCTACTTCTTCCCCAGCCAACGATACCCAAACAGAAACATCAACAGCAACACCGGTCGAAGATGACGGAAAACACACCCAAAAGAAACAACCCACAAAGTTCTTGACTTGGAATGCAAACAGCTTCCTTCTCCGGGTTAAAAACAACTGGCCGGAGTTCACCAAGCTTATCGACTCCATTGATCCTGATGTTATAGCCAT...

Protein

Download Protein FASTA

392 aa · LXL04_009441|LXL04_009441|OH1004|PROTEIN

MKRFFQPVQKDASFKKPTLSSTSSPANDTQTETSTATPVEDDGKHTQKKQPTKFLTWNANSFLLRVKNNWPEFTKLIDSIDPDVIAIQVPFCPSNFHDFTVYKAEIQILLEVRMPAAGAKGAPKNPRELKDDNNSSREEKLIITRALSGPTFRKYNVWWSLSDSKYAGTALFIKKCFPPKKVSFNLDPSVSKHEPDGRVIIAEFESFRIMNTYVPNNGWKDEENSFQRRRKWDKRMQEFILQSTDKSLIWCGDLNVSHEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009441`
TK1151 ID	TkA04G067930
OH-1004 ID	LXL04_009441
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	34.100
Protein coverage (%)	TK1151 43.195 / OH-1004 41.582 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009441

Location Chr02:126670757-126672717 (-)

Description Similar to APE1L: DNA-(apurinic or apyrimidinic site) endonuclease

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48425`	Apurinic/apyrimidinic (AP) endonuclease involved in active DNA demethylation and gene imprinting.	Requirement for abasic endonuclease gene homologues in Arabidopsis seed development.2009 · DOI: 10.1371/journal.pone.0004297 AP endonucleases process 5-methylcytosine excision intermediates during active DNA demethylation in Arabidopsis.2014 · DOI: 10.1093/nar/gku834

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009441 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006308 DNA catabolic process Biological Process

GO:0006310 DNA recombination Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0014912 negative regulation of smooth muscle cell migration Biological Process

GO:0043488 regulation of mRNA stability Biological Process

GO:0044029 positive regulation of gene expression via chromosomal CpG island demethylation Biological Process

GO:0045454 cell redox homeostasis Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

KEGG gene cross-reference

ath:AT3G48425

mmu:11792

pfa:PF3D7_0305600

rno:79116

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.541

Rank 1 · LXL04_009441 · OH-1004

Cytoplasm0.400

Rank 2 · LXL04_009441 · OH-1004

Mitochondrion0.178

Rank 3 · LXL04_009441 · OH-1004

Cell membrane0.035

Rank 4 · LXL04_009441 · OH-1004

Peroxisome0.033

Rank 5 · LXL04_009441 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03372.30Exo_endo_phos55-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009441	`PF03372.30`	Exo_endo_phos	55	374	2.7e-15	57.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XF07`	Arabidopsis thaliana	DNA-(apurinic or apyrimidinic site) endonuclease	64.141%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card