Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1905 bp · LXL04_009434|LXL04_009434|OH1004|cDNA
ATGGGGAAGAAGACGAAGAAGCCGGGAAAGGGAAAGGAGAAAACGGAGAGAAAAACGGCCAAAGCCGATGAGAAAAAAGCTCGTAGAGAGTCTAAGAAAATCTCCCCGGAAGACGACATTGATGCCATTCTGCTAAGCATACAGAAGGAAGAAGCTAAGAAAAAAGAAGTTCATGTCGAAGAAAACGCTCCTCGACCATCTCCCCGGTCAAATTGCTCGCTAAGCATCAATCCATTGAAAGAGACCGAAATGATACTATA...
1905 bp · LXL04_009434|LXL04_009434|OH1004|CDS
ATGGGGAAGAAGACGAAGAAGCCGGGAAAGGGAAAGGAGAAAACGGAGAGAAAAACGGCCAAAGCCGATGAGAAAAAAGCTCGTAGAGAGTCTAAGAAAATCTCCCCGGAAGACGACATTGATGCCATTCTGCTAAGCATACAGAAGGAAGAAGCTAAGAAAAAAGAAGTTCATGTCGAAGAAAACGCTCCTCGACCATCTCCCCGGTCAAATTGCTCGCTAAGCATCAATCCATTGAAAGAGACCGAAATGATACTATA...
Protein
Download Protein FASTA634 aa · LXL04_009434|LXL04_009434|OH1004|PROTEIN
MGKKTKKPGKGKEKTERKTAKADEKKARRESKKISPEDDIDAILLSIQKEEAKKKEVHVEENAPRPSPRSNCSLSINPLKETEMILYGGEFYNGTKTFVYGDLYRYDVDKGDWKLISSPNSPPPRSAHQAVAWKNYLYVYGGEFTSPNQERFHHYKDFWMLDLKTNQWEQLNYKGCPSPRSGHRMILYKHKLVVFGGFYDTLREVRYFNDLHVFDLDTFKWQEIKPTPGCLWPSARSGFQLFVYQDDIYMYGGYSKEVSS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_009434 |
|---|---|
| TK1151 ID | TkA03G439850 |
| OH-1004 ID | LXL04_009434 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.900 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_009434 |
|---|---|
| Location | Chr02:126547308-126550912 (+) |
| Description | Similar to Klhdc4: Kelch domain-containing protein 4 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0007165 signal transduction Biological Process GO:0008360 regulation of cell shape Biological Process GO:0061245 establishment or maintenance of bipolar cell polarity Biological Process GO:1990896 protein localization to cell cortex of cell tip Biological Process GO:0005737 cytoplasm Cellular Component GO:0005881 cytoplasmic microtubule Cellular Component GO:0015630 microtubule cytoskeleton Cellular Component GO:0032153 cell division site Cellular Component GO:0035838 growing cell tip Cellular Component GO:0035839 non-growing cell tip Cellular Component GO:0035840 old growing cell tip Cellular Component GO:0051285 cell cortex of cell tip Cellular Component |
| KEGG gene cross-reference | hsa:54758 pon:100172995 sce:YPL263C spo:2539047 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24681.2Kelch_KLHDC2_KLHL20_DRC741-253 aaPF13854.13Kelch_HCF50-199 aaPF13415.13Beta-prop_FBX4257-147 aaPF13415.13Beta-prop_FBX4281-257 aaPF24981.2Beta-prop_ATRN-LZTR184-174 aaPF13964.13Beta-prop_Calicin101-222 aaPF24996.1NANM103-224 aaPF25210.2Kelch_FKB95113-266 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_009434 | PF24681.2 | Kelch_KLHDC2_KLHL20_DRC7 | 41 | 253 | 2.4e-62 | 210.8 |
| LXL04_009434 | PF13854.13 | Kelch_HCF | 50 | 199 | 8.2e-24 | 85.2 |
| LXL04_009434 | PF13415.13 | Beta-prop_FBX42 | 57 | 147 | 4.3e-62 | 210.1 |
| LXL04_009434 | PF13415.13 | Beta-prop_FBX42 | 81 | 257 | 4.3e-62 | 210.1 |
| LXL04_009434 | PF24981.2 | Beta-prop_ATRN-LZTR1 | 84 | 174 | 4.3e-47 | 161.5 |
| LXL04_009434 | PF13964.13 | Beta-prop_Calicin | 101 | 222 | 1.2e-06 | 28.5 |
| LXL04_009434 | PF24996.1 | NANM | 103 | 224 | 5.5e-15 | 55.8 |
| LXL04_009434 | PF25210.2 | Kelch_FKB95 | 113 | 266 | 1.3e-09 | 38.8 |
| LXL04_009434 | PF13418.13 | Beta-prop_TYW4 | 122 | 316 | 3.6e-08 | 34.3 |
| LXL04_009434 | PF01344.32 | Kelch_1 | 124 | 171 | 7.1e-24 | 83.7 |
| LXL04_009434 | PF24981.2 | Beta-prop_ATRN-LZTR1 | 155 | 226 | 4.3e-47 | 161.5 |
| LXL04_009434 | PF01344.32 | Kelch_1 | 179 | 226 | 7.1e-24 | 83.7 |
| LXL04_009434 | PF07646.22 | Kelch_2 | 179 | 227 | 9.8e-24 | 82.8 |
| LXL04_009434 | PF24981.2 | Beta-prop_ATRN-LZTR1 | 209 | 289 | 4.3e-47 | 161.5 |
| LXL04_009434 | PF07646.22 | Kelch_2 | 243 | 289 | 9.8e-24 | 82.8 |
| LXL04_009434 | PF13415.13 | Beta-prop_FBX42 | 266 | 349 | 4.3e-62 | 210.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.