LXL04_009320 | RubberDandelionOmics

Gene overview

LXL04_009320

Reference: OH-1004 Chr: Chr02 Coordinates: 122805915-122806660 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

363 bp · LXL04_009320|LXL04_009320|OH1004|cDNA

ATGGGCTTCGTATATACTATCGTCCTCATTTACATCAGCACCATTCCGTGTTCGTTTGTAGGGTTTGAGGGTTCTTCAACTTTTCATCGCTTTTCTTACGATCACCGAAGTTGCTTTCTCCCTTCGATTTCCATGGACGCTTTATCCAACCCGCAGTTACAGCAGATGATCAATCAAGAAAAGGAGAGGGCAATGGCGAATGAGATGATAGCAAAGCTAACAAGTGCGTGTTGGGATAAGTGCATTACGAGTACTCCAGG...

CDS

Download CDS FASTA

363 bp · LXL04_009320|LXL04_009320|OH1004|CDS

ATGGGCTTCGTATATACTATCGTCCTCATTTACATCAGCACCATTCCGTGTTCGTTTGTAGGGTTTGAGGGTTCTTCAACTTTTCATCGCTTTTCTTACGATCACCGAAGTTGCTTTCTCCCTTCGATTTCCATGGACGCTTTATCCAACCCGCAGTTACAGCAGATGATCAATCAAGAAAAGGAGAGGGCAATGGCGAATGAGATGATAGCAAAGCTAACAAGTGCGTGTTGGGATAAGTGCATTACGAGTACTCCAGG...

Protein

Download Protein FASTA

120 aa · LXL04_009320|LXL04_009320|OH1004|PROTEIN

MGFVYTIVLIYISTIPCSFVGFEGSSTFHRFSYDHRSCFLPSISMDALSNPQLQQMINQEKERAMANEMIAKLTSACWDKCITSTPGSKFSSSESSCLSNCAQRYMDMSIMIVKRFQSMQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009320`
TK1151 ID	TkA03G418230
OH-1004 ID	LXL04_009320
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 43.357 / OH-1004 51.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009320

Location Chr02:122805915-122806660 (+)

Description Similar to TIM8: Mitochondrial import inner membrane translocase subunit TIM8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50810`	Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009320 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0045039 protein insertion into mitochondrial inner membrane Biological Process

GO:0072655 establishment of protein localization to mitochondrion Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0042719 mitochondrial intermembrane space chaperone complex Cellular Component

GO:0046872 metal ion binding Molecular Function

GO:0140318 protein transporter activity Molecular Function

KEGG gene cross-reference

ath:AT5G50810

cnb:CNBF3420

cne:CNF01290

dme:Dmel_CG1728

tru:101061507

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.338

Rank 1 · LXL04_009320 · OH-1004

Peroxisome0.301

Rank 2 · LXL04_009320 · OH-1004

Cytoplasm0.150

Rank 3 · LXL04_009320 · OH-1004

Plastid0.147

Rank 4 · LXL04_009320 · OH-1004

Nucleus0.082

Rank 5 · LXL04_009320 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02953.21zf-Tim10_DDP55-118 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009320	`PF02953.21`	zf-Tim10_DDP	55	118	1.6e-25	89.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XGY4`	Arabidopsis thaliana	Mitochondrial import inner membrane translocase subunit TIM8	74.286%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card