LXL04_009312 | RubberDandelionOmics

Gene overview

LXL04_009312

Reference: OH-1004 Chr: Chr02 Coordinates: 122730275-122731939 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1665 bp · LXL04_009312|LXL04_009312|OH1004|cDNA

ATGAAGCTGTCGGAAAATGAAGCCGACGTCGTCGAGGCCTCTAACCTCCAGCTTCTTCAATCTCTACTCGACTCAATCCCCCACACCGTCTCCTTCAAAGGAAAATGGTCTCTCATCGGAACGAAGCTTTCCGATCTCAAATCCAAACTTTCCGACCTCTCCGACTTCCCCTCCAACTCCCTCTCCGTCGATATCCTCCATTCCCTCTCCCAAACACTCTCTCAAGCACTTTCCTTGTCACTCATTTGTCACAGCGCCAA...

CDS

Download CDS FASTA

1665 bp · LXL04_009312|LXL04_009312|OH1004|CDS

ATGAAGCTGTCGGAAAATGAAGCCGACGTCGTCGAGGCCTCTAACCTCCAGCTTCTTCAATCTCTACTCGACTCAATCCCCCACACCGTCTCCTTCAAAGGAAAATGGTCTCTCATCGGAACGAAGCTTTCCGATCTCAAATCCAAACTTTCCGACCTCTCCGACTTCCCCTCCAACTCCCTCTCCGTCGATATCCTCCATTCCCTCTCCCAAACACTCTCTCAAGCACTTTCCTTGTCACTCATTTGTCACAGCGCCAA...

Protein

Download Protein FASTA

554 aa · LXL04_009312|LXL04_009312|OH1004|PROTEIN

MKLSENEADVVEASNLQLLQSLLDSIPHTVSFKGKWSLIGTKLSDLKSKLSDLSDFPSNSLSVDILHSLSQTLSQALSLSLICHSANPPGGKLKTQNEVDSISAKVDSHIKDCEVLITSGVLHDGVVSTSSTSVSKRESIRVESRNLITRLQIGSNESRNSALDSLLGLLQEDDKNVLIAVAQGVVPVLVRLLDSSSTSEIKEKTVTAIARVSTVDSSKHVLIAEGLLLLHHLLRILESGSGFAKEKACITLNALSNTKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009312`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009312

Location Chr02:122730275-122731939 (+)

Description Similar to PUB13: U-box domain-containing protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46510`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g23030`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g71020`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At2g28830`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At2g23140`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009312 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031648 protein destabilization Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0090333 regulation of stomatal closure Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G23030

ath:AT1G71020

ath:AT2G28830

ath:AT3G46510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.579

Rank 1 · LXL04_009312 · OH-1004

Nucleus0.326

Rank 2 · LXL04_009312 · OH-1004

Cell membrane0.166

Rank 3 · LXL04_009312 · OH-1004

Endoplasmic reticulum0.049

Rank 4 · LXL04_009312 · OH-1004

Lysosome / Vacuole0.048

Rank 5 · LXL04_009312 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23005.2DUF703215-121 aa

PF25598.2ARM_PUB146-266 aa

PF24768.2ARM_ARMC5166-340 aa

PF00514.30Arm174-210 aa

PF04826.20Arm_2188-384 aa

PF24768.2ARM_ARMC5225-453 aa

PF24768.2ARM_ARMC5348-526 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009312	`PF23005.2`	DUF7032	15	121	6.1e-32	110.5
LXL04_009312	`PF25598.2`	ARM_PUB	146	266	9.8e-12	45.6
LXL04_009312	`PF24768.2`	ARM_ARMC5	166	340	1.1e-19	71.7
LXL04_009312	`PF00514.30`	Arm	174	210	2.1e-17	63.2
LXL04_009312	`PF04826.20`	Arm_2	188	384	2.5e-08	34.4
LXL04_009312	`PF24768.2`	ARM_ARMC5	225	453	1.1e-19	71.7
LXL04_009312	`PF24768.2`	ARM_ARMC5	348	526	1.1e-19	71.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SNC6`	Arabidopsis thaliana	U-box domain-containing protein 13	30.588%	Swiss-Prot	weak database homology
`Q8GUG9`	Arabidopsis thaliana	U-box domain-containing protein 11	27.933%	Swiss-Prot	weak database homology
`Q9C9A6`	Arabidopsis thaliana	U-box domain-containing protein 10	26.364%	Swiss-Prot	weak database homology
`Q9ZV31`	Arabidopsis thaliana	U-box domain-containing protein 12	30.769%	Swiss-Prot	weak database homology
`O22193`	Arabidopsis thaliana	U-box domain-containing protein 4	28.141%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card