LXL04_009147 | RubberDandelionOmics

Gene overview

LXL04_009147

Reference: OH-1004 Chr: Chr02 Coordinates: 118583552-118586635 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1383 bp · LXL04_009147|LXL04_009147|OH1004|cDNA

ATGCCGTTAACCGTATCTGCCTCTCTGGTCTTCATCTCCTCCGAAAACCCTAGATATTTGTTTATTCTCTTTCAGTTCGACGAAAGAGGAGTTATCATGGGCGAAGTGAAGGATAACGACGCTTACGAGGAGGAGCTTCTCGATTATGAAGAGGAAGACGAAAAAGCCCCCGAGTCCATCAACGGAAAACCTGGTTCAGAGACCGTCAAAAAGGGCTATGTTGGAATTCACAGTTCCGGGTTCCGAGACTTCTTGCTGAA...

CDS

Download CDS FASTA

1383 bp · LXL04_009147|LXL04_009147|OH1004|CDS

ATGCCGTTAACCGTATCTGCCTCTCTGGTCTTCATCTCCTCCGAAAACCCTAGATATTTGTTTATTCTCTTTCAGTTCGACGAAAGAGGAGTTATCATGGGCGAAGTGAAGGATAACGACGCTTACGAGGAGGAGCTTCTCGATTATGAAGAGGAAGACGAAAAAGCCCCCGAGTCCATCAACGGAAAACCTGGTTCAGAGACCGTCAAAAAGGGCTATGTTGGAATTCACAGTTCCGGGTTCCGAGACTTCTTGCTGAA...

Protein

Download Protein FASTA

460 aa · LXL04_009147|LXL04_009147|OH1004|PROTEIN

MPLTVSASLVFISSENPRYLFILFQFDERGVIMGEVKDNDAYEEELLDYEEEDEKAPESINGKPGSETVKKGYVGIHSSGFRDFLLKPELLRAIVDSGFEHPSEVQHECIPQAILGMDVICQAKSGMGKTAVFVLSTLQQIEPVAGQVAALVLCHTRELAYQICHEFERFSRYLPDLKVAVFYGGVNIRTHKELLKNECPHIVVGTPGRVLGLARDKDLGLKNVRHFILDECDKMLESLDMRKDVQDIFKMTPHDKQVMM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009147`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009147

Location Chr02:118583552-118586635 (-)

Description Similar to RH56: DEAD-box ATP-dependent RNA helicase 56

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g11200`	ATP-dependent RNA helicase involved in pre-mRNA splicing.	No verified direct reference in this release
`At5g11170`	ATP-dependent RNA helicase involved in pre-mRNA splicing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0549700`	ATP-binding RNA helicase involved in pre-mRNA splicing.	Rice APOPTOSIS INHIBITOR5 coupled with two DEAD-box adenosine 5'-triphosphate-dependent RNA helicases regulates tapetum degeneration.2011 · DOI: 10.1105/tpc.110.082636
`Os01g0550000`	ATP-binding RNA helicase involved in pre-mRNA splicing.	Rice APOPTOSIS INHIBITOR5 coupled with two DEAD-box adenosine 5'-triphosphate-dependent RNA helicases regulates tapetum degeneration.2011 · DOI: 10.1105/tpc.110.082636

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009147 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009555 pollen development Biological Process

GO:0010099 regulation of photomorphogenesis Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0048653 anther development Biological Process

GO:0051028 mRNA transport Biological Process

GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation Biological Process

KEGG gene cross-reference

ath:AT5G11170

ath:AT5G11200

dosa:Os01g0549700

dosa:Os01g0550000

osa:4326192

osa:4326193

rno:114612

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.539

Rank 1 · LXL04_009147 · OH-1004

Nucleus0.493

Rank 2 · LXL04_009147 · OH-1004

Endoplasmic reticulum0.059

Rank 3 · LXL04_009147 · OH-1004

Mitochondrion0.058

Rank 4 · LXL04_009147 · OH-1004

Cell membrane0.053

Rank 5 · LXL04_009147 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD104-269 aa

PF04851.22ResIII119-266 aa

PF00271.38Helicase_C308-416 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009147	`PF00270.36`	DEAD	104	269	2.1e-40	138.9
LXL04_009147	`PF04851.22`	ResIII	119	266	3.4e-07	31.0
LXL04_009147	`PF00271.38`	Helicase_C	308	416	4.1e-30	105.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFN6`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 56	92.056%	Swiss-Prot	strong database homology
`Q56XG6`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 15	92.056%	Swiss-Prot	strong database homology
`Q0JM17`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 56	87.879%	Swiss-Prot	strong database homology
`Q5JK84`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 15	87.879%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card