LXL04_008987 | RubberDandelionOmics

Gene overview

LXL04_008987

Reference: OH-1004 Chr: Chr02 Coordinates: 115211854-115213587 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · LXL04_008987|LXL04_008987|OH1004|cDNA

ATGTGCTTTACAGGAGATTCGTACACGAATAAATCCATTATTGGGGGTGTTACTGGAGGTGTAAGCTTACTGTTACTTACACTAGCAATTTTCTTATGGTGTCACAAAACCAAAACCACAGGTAGAGGCCAACGAGATATTTCAACCGGATCTACTGAATTACTACAAGGTCCAGTTAGATATAGCTACAATGATTTAAAATTAGCCACGGATAATTTCAGCCAAGAGAACAAACTTGGAGGAGGAGTATTTGGAGAAGT...

CDS

Download CDS FASTA

1158 bp · LXL04_008987|LXL04_008987|OH1004|CDS

ATGTGCTTTACAGGAGATTCGTACACGAATAAATCCATTATTGGGGGTGTTACTGGAGGTGTAAGCTTACTGTTACTTACACTAGCAATTTTCTTATGGTGTCACAAAACCAAAACCACAGGTAGAGGCCAACGAGATATTTCAACCGGATCTACTGAATTACTACAAGGTCCAGTTAGATATAGCTACAATGATTTAAAATTAGCCACGGATAATTTCAGCCAAGAGAACAAACTTGGAGGAGGAGTATTTGGAGAAGT...

Protein

Download Protein FASTA

385 aa · LXL04_008987|LXL04_008987|OH1004|PROTEIN

MCFTGDSYTNKSIIGGVTGGVSLLLLTLAIFLWCHKTKTTGRGQRDISTGSTELLQGPVRYSYNDLKLATDNFSQENKLGGGVFGEVYKGIVKDGGEIAIKKTFMASRRGKTDFSDQLKIISNVHHRHILRILGYCIKGTQLFLVHQFMENCSLDHFLIGEKKRTLNWKQRFEIIYGTARGLAYLHEQYHVTIIHTDIRASNILLDSEFQPKIADFGLIRLLPEDKTHLSTKGRGSLNSGYLAPEYAIHGQLSEKVDTYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008987`
TK1151 ID	TkA03G298880
OH-1004 ID	LXL04_008987
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 99.740 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008987

Location Chr02:115211854-115213587 (+)

Description Similar to CRK2: Cysteine-rich receptor-like protein kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70520`	Cysteine-rich receptor-like protein kinase 2.	No verified direct reference in this release
`At1g56140`	Probable LRR receptor-like serine/threonine-protein kinase At1g56140.	No verified direct reference in this release
`At1g56130`	Probable LRR receptor-like serine/threonine-protein kinase At1g56130.	No verified direct reference in this release
`At4g11490`	Putative cysteine-rich receptor-like protein kinase 33.	No verified direct reference in this release
`At1g16670`	Negative regulator of freezing tolerance that phosphorylates 14-3-3 proteins (e.g. GRF6) thus triggering their translocation from the cytosol to the nucleus in response to cold stress.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008987 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009625 response to insect Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010193 response to ozone Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050826 response to freezing Biological Process

KEGG gene cross-reference

ath:AT1G16670

ath:AT1G56130

ath:AT1G56140

ath:AT1G70520

ath:AT4G11490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.792

Rank 1 · LXL04_008987 · OH-1004

Cytoplasm0.150

Rank 2 · LXL04_008987 · OH-1004

Nucleus0.090

Rank 3 · LXL04_008987 · OH-1004

Endoplasmic reticulum0.070

Rank 4 · LXL04_008987 · OH-1004

Golgi apparatus0.032

Rank 5 · LXL04_008987 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase73-304 aa

PF07714.24PK_Tyr_Ser-Thr75-281 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008987	`PF00069.32`	Pkinase	73	304	6.8e-38	131.3
LXL04_008987	`PF07714.24`	PK_Tyr_Ser-Thr	75	281	2.6e-44	152.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAL3`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 2	44.343%	Swiss-Prot	moderate database homology
`C0LGH3`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g56140	43.023%	Swiss-Prot	moderate database homology
`C0LGH2`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g56130	42.899%	Swiss-Prot	moderate database homology
`Q9LDN1`	Arabidopsis thaliana	Putative cysteine-rich receptor-like protein kinase 33	40.498%	Swiss-Prot	moderate database homology
`Q93YN1`	Arabidopsis thaliana	Cold-responsive protein kinase 1	40.782%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card