LXL04_008942 | RubberDandelionOmics

Gene overview

LXL04_008942

Reference: OH-1004 Chr: Chr02 Coordinates: 113467252-113473540 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4611 bp · LXL04_008942|LXL04_008942|OH1004|cDNA

ATTCCTATATTTCCCCCGCATTCGTGTCTATCTCGCTTGCACCTTCCTTTACGCAGTCAAAAAACCCTTCTTCTCTTTGGCGTCTCCCAGCTCTCAATCTCTCTCCGATCATCAATGGCCGGCAAGACCGACTTCGATTCTTCTCTCCCTAACTCTCAGATCTCCAGAGATGTGCAGGGGTCGGACAGTTGTATTCCACTTTCACCACAGTGGCTTCTGTCGAAACCTGGGGAGAACAAGATAGGAACTCCAACCTCGGA...

CDS

Download CDS FASTA

4575 bp · LXL04_008942|LXL04_008942|OH1004|CDS

TTGCACCTTCCTTTACGCAGTCAAAAAACCCTTCTTCTCTTTGGCGTCTCCCAGCTCTCAATCTCTCTCCGATCATCAATGGCCGGCAAGACCGACTTCGATTCTTCTCTCCCTAACTCTCAGATCTCCAGAGATGTGCAGGGGTCGGACAGTTGTATTCCACTTTCACCACAGTGGCTTCTGTCGAAACCTGGGGAGAACAAGATAGGAACTCCAACCTCGGATGTCCCCACCAGTCCTTTTCCAGCATTCGCCAACCG...

Protein

Download Protein FASTA

1524 aa · LXL04_008942|LXL04_008942|OH1004|PROTEIN

MHLPLRSQKTLLLFGVSQLSISLRSSMAGKTDFDSSLPNSQISRDVQGSDSCIPLSPQWLLSKPGENKIGTPTSDVPTSPFPAFANRLDFMKSPGPDDTNSHKKKDVFRPSVLESRERWRDEERDTSSFVRKDTNNNNRWRGEVDTKELGDSRKVDRWTTDTNITTPGKQQHQQQQQQHYGESQYSHSSRRAPSEKWGDTTANKDPRESKWNNRWGPPDDNKETERDSKWSESGKDHEEGEHPRPWRPRGRAEPPHQQSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008942`
TK1151 ID	TkA03G306980
OH-1004 ID	LXL04_008942
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.800
Protein coverage (%)	TK1151 99.222 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008942

Location Chr02:113467252-113473540 (+)

Description Similar to EXA1: Protein ESSENTIAL FOR POTEXVIRUS ACCUMULATION 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42950`	Translational repressor involved in the negative regulation of immune receptor accumulation via the inhibition of nucleotide- binding leucine-rich repeat (NLR) receptor mediated defense.	EXA1, a GYF domain protein, is responsible for loss-of-susceptibility to plantago asiatica mosaic virus in Arabidopsis thaliana.2016 · DOI: 10.1111/tpj.13265

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008942 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002229 defense response to oomycetes Biological Process

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0012501 programmed cell death Biological Process

GO:0016441 post-transcriptional gene silencing Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0031571 mitotic G1 DNA damage checkpoint signaling Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045947 negative regulation of translational initiation Biological Process

KEGG gene cross-reference

ath:AT5G42950

hsa:26058

mmu:227331

spo:2543445

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.558

Rank 1 · LXL04_008942 · OH-1004

Nucleus0.235

Rank 2 · LXL04_008942 · OH-1004

Golgi apparatus0.171

Rank 3 · LXL04_008942 · OH-1004

Cell membrane0.081

Rank 4 · LXL04_008942 · OH-1004

Endoplasmic reticulum0.074

Rank 5 · LXL04_008942 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02213.22GYF513-550 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008942	`PF02213.22`	GYF	513	550	1.8e-11	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMM3`	Arabidopsis thaliana	Protein ESSENTIAL FOR POTEXVIRUS ACCUMULATION 1	38.157%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card