LXL04_008557 | RubberDandelionOmics

Gene overview

LXL04_008557

Reference: OH-1004 Chr: Chr02 Coordinates: 102696515-102697976 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · LXL04_008557|LXL04_008557|OH1004|cDNA

ATGTCGAAGATGAGTTATTCAAGTGCTTCAATGGGTTCCGGTAGTAGAACCGCTAGGAGAACCGTTGAATTTGGAAGGACATATGTTGTGAGGCCAAAAGCAAAACACCAAGCAACTATAGTTTGGTTGCATGGACTTGGCGATAATGGTTCAAGCTGGTCACAACTCTTGGACAATCTTCCTCTTCCAAATATAAAATGGATATGCCCAACTGCTCCTACTCGCCCAGTGAGCGCGCTTGGTGGATTCCCTTGTGCTGC...

CDS

Download CDS FASTA

768 bp · LXL04_008557|LXL04_008557|OH1004|CDS

ATGTCGAAGATGAGTTATTCAAGTGCTTCAATGGGTTCCGGTAGTAGAACCGCTAGGAGAACCGTTGAATTTGGAAGGACATATGTTGTGAGGCCAAAAGCAAAACACCAAGCAACTATAGTTTGGTTGCATGGACTTGGCGATAATGGTTCAAGCTGGTCACAACTCTTGGACAATCTTCCTCTTCCAAATATAAAATGGATATGCCCAACTGCTCCTACTCGCCCAGTGAGCGCGCTTGGTGGATTCCCTTGTGCTGC...

Protein

Download Protein FASTA

255 aa · LXL04_008557|LXL04_008557|OH1004|PROTEIN

MSKMSYSSASMGSGSRTARRTVEFGRTYVVRPKAKHQATIVWLHGLGDNGSSWSQLLDNLPLPNIKWICPTAPTRPVSALGGFPCAAWFDEGELSEDGPNDVEGLDASIAHIANLLSTEPSDVKLGIGGFSMGAACALYSAACFAQGKYGNGNPYPINLKAVVGLSGWLPGARNLRNKIGGSNEAARRAASLPILLCHGLCDEVVPYTYGERSSQMMSSAGFRYVTFKTYQGLGHYTVPKEMEEVCQWLNGRLAA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008557`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_008557`
Location	Chr02:102696515-102697976 (+)
Description	Similar to Lypla2: Acyl-protein thioesterase 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008557` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002084 protein depalmitoylation Biological Process GO:0006631 fatty acid metabolic process Biological Process GO:0015908 fatty acid transport Biological Process GO:0042997 negative regulation of Golgi to plasma membrane protein transport Biological Process GO:0046464 acylglycerol catabolic process Biological Process GO:1905336 negative regulation of aggrephagy Biological Process GO:1905344 prostaglandin catabolic process Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005795 Golgi stack Cellular Component
KEGG gene cross-reference	hsa:10434 hsa:11313 mmu:26394 pon:100172358 rno:83510 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.645

Rank 1 · LXL04_008557 · OH-1004

Cytoplasm0.343

Rank 2 · LXL04_008557 · OH-1004

Plastid0.084

Rank 3 · LXL04_008557 · OH-1004

Cell membrane0.054

Rank 4 · LXL04_008557 · OH-1004

Endoplasmic reticulum0.043

Rank 5 · LXL04_008557 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02230.23Abhydrolase_228-250 aa

PF03959.20FSH164-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008557	`PF02230.23`	Abhydrolase_2	28	250	5.5e-42	144.8
LXL04_008557	`PF03959.20`	FSH1	64	220	1.2e-09	38.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card