LXL04_008324 | RubberDandelionOmics

Gene overview

LXL04_008324

Reference: OH-1004 Chr: Chr02 Coordinates: 96557560-96558171 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

612 bp · LXL04_008324|LXL04_008324|OH1004|cDNA

ATGGGTCAAGCCGAGAAATTAATGAACCAGATCATGGAGCTCAAGTTCACCGCCAAGAGCCTACAACGCCAGGCAAGAAAGTGCGAGAAAGACGAGAAATCGGAGAAACTTAAAGTCAAGAAGGCGATCGAAAAAGGTAATATGGACGGAGCACGGATCTACGCTGAAAACGCGATCCGTAAGCGTAGCGAACAGATGAACTACCTTCGTTTATCCTCACGCCTTGATGCAGTCGTCGCAAGGCTCGATACGCAGGCCAA...

CDS

Download CDS FASTA

612 bp · LXL04_008324|LXL04_008324|OH1004|CDS

ATGGGTCAAGCCGAGAAATTAATGAACCAGATCATGGAGCTCAAGTTCACCGCCAAGAGCCTACAACGCCAGGCAAGAAAGTGCGAGAAAGACGAGAAATCGGAGAAACTTAAAGTCAAGAAGGCGATCGAAAAAGGTAATATGGACGGAGCACGGATCTACGCTGAAAACGCGATCCGTAAGCGTAGCGAACAGATGAACTACCTTCGTTTATCCTCACGCCTTGATGCAGTCGTCGCAAGGCTCGATACGCAGGCCAA...

Protein

Download Protein FASTA

203 aa · LXL04_008324|LXL04_008324|OH1004|PROTEIN

MGQAEKLMNQIMELKFTAKSLQRQARKCEKDEKSEKLKVKKAIEKGNMDGARIYAENAIRKRSEQMNYLRLSSRLDAVVARLDTQAKMTTISKSMGSIVKSLESTLATGNLQKMSETMDQFERQFVNMEVQAEFMESSMAGSTSLSTPEGEVNSLMQQVADDYGLEVSVGLPQPAAHAVPTKNTEKVEEDNLSRRLAELKARG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008324`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008324

Location Chr02:96557560-96558171 (+)

Description Similar to CHMP1A: ESCRT-related protein CHMP1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17730`	Involved in ESCRT-dependent multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	The ESCRT-related CHMP1A and B proteins mediate multivesicular body sorting of auxin carriers in Arabidopsis and are required for plant development.2009 · DOI: 10.1105/tpc.108.064865 The endosomal protein CHARGED MULTIVESICULAR BODY PROTEIN1 regulates the autophagic turnover of plastids in Arabidopsis.2015 · DOI: 10.1105/tpc.114.135939
`At1g73030`	Involved in ESCRT-dependent multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	The ESCRT-related CHMP1A and B proteins mediate multivesicular body sorting of auxin carriers in Arabidopsis and are required for plant development.2009 · DOI: 10.1105/tpc.108.064865 The endosomal protein CHARGED MULTIVESICULAR BODY PROTEIN1 regulates the autophagic turnover of plastids in Arabidopsis.2015 · DOI: 10.1105/tpc.114.135939

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0643300`	Involved in ESCRT-dependent multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008324 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000578 embryonic axis specification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006623 protein targeting to vacuole Biological Process

GO:0006914 autophagy Biological Process

GO:0007080 mitotic metaphase chromosome alignment Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015031 protein transport Biological Process

GO:0031468 nuclear membrane reassembly Biological Process

GO:0032509 endosome transport via multivesicular body sorting pathway Biological Process

GO:0039702 viral budding via host ESCRT complex Biological Process

GO:0043162 ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

KEGG gene cross-reference

ath:AT1G17730

ath:AT1G73030

ddi:DDB_G0267394

dosa:Os06g0643300

pon:100173638

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.867

Rank 1 · LXL04_008324 · OH-1004

Nucleus0.242

Rank 2 · LXL04_008324 · OH-1004

Cell membrane0.088

Rank 3 · LXL04_008324 · OH-1004

Mitochondrion0.055

Rank 4 · LXL04_008324 · OH-1004

Endoplasmic reticulum0.046

Rank 5 · LXL04_008324 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03357.27Snf711-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008324	`PF03357.27`	Snf7	11	173	1.6e-14	54.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LE58`	Arabidopsis thaliana	ESCRT-related protein CHMP1A	88.177%	Swiss-Prot	strong database homology
`Q9SSM4`	Arabidopsis thaliana	ESCRT-related protein CHMP1B	88.177%	Swiss-Prot	strong database homology
`Q84VG1`	Oryza sativa subsp. japonica	ESCRT-related protein CHMP1	82.439%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card