RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_008321
Reference: OH-1004 Chr: Chr02 Coordinates: 96493374-96494789 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

585 bp · LXL04_008321|LXL04_008321|OH1004|cDNA

ATGAGTGTTTTGAGCTTCAACCTACCGTTATCCTTCGGATCTGTTCAAGGACTTGATGCTAAGACGATCTATACTCCGATCTGCTATACGACGAGAGCAACAAGATGTCAGAGGGCTTCAGTTATTGCGAACGGGATAGGAGGAGGATCGGCCAAGTACAAAGGAACACAGATGAGAGAGAAAAAGCTGACGGAGTTGATCGAGTCAAAAATCGCTGAAGCTACGCAAGTTTGTGAGGGGGATCGTGACTCCGACGAGTG...

CDS

Download CDS FASTA

585 bp · LXL04_008321|LXL04_008321|OH1004|CDS

ATGAGTGTTTTGAGCTTCAACCTACCGTTATCCTTCGGATCTGTTCAAGGACTTGATGCTAAGACGATCTATACTCCGATCTGCTATACGACGAGAGCAACAAGATGTCAGAGGGCTTCAGTTATTGCGAACGGGATAGGAGGAGGATCGGCCAAGTACAAAGGAACACAGATGAGAGAGAAAAAGCTGACGGAGTTGATCGAGTCAAAAATCGCTGAAGCTACGCAAGTTTGTGAGGGGGATCGTGACTCCGACGAGTG...

Protein

Download Protein FASTA

194 aa · LXL04_008321|LXL04_008321|OH1004|PROTEIN

MSVLSFNLPLSFGSVQGLDAKTIYTPICYTTRATRCQRASVIANGIGGGSAKYKGTQMREKKLTELIESKIAEATQVCEGDRDSDECKVAWDEVEEVSQAKADLRRKLDENKDPLQSFCEENPETDECLLVLTIVKTINQRSLSWLKSKWNPNRDFSVGNKCGGLDPSPSEHCIKHLGFWITRKWIAGGGVLLA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_008321
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_008321
LocationChr02:96493374-96494789 (+)
DescriptionSimilar to CP12-3: Calvin cycle protein CP12-3, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g76560 Acts as a linker essential in the assembly of a core complex of PRK/GAPDH.
In vitro characterization of Arabidopsis CP12 isoforms reveals common biochemical and molecular properties.2010 · DOI: 10.1016/j.jplph.2010.02.008
At3g62410 Acts as a linker essential in the assembly of a core complex of PRK/GAPDH.
In vitro characterization of Arabidopsis CP12 isoforms reveals common biochemical and molecular properties.2010 · DOI: 10.1016/j.jplph.2010.02.008
At2g47400 Acts as a linker essential in the assembly of a core complex of PRK/GAPDH.
In vitro characterization of Arabidopsis CP12 isoforms reveals common biochemical and molecular properties.2010 · DOI: 10.1016/j.jplph.2010.02.008

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_008321 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009416 response to light stimulus Biological Process
GO:0009744 response to sucrose Biological Process
GO:0018316 peptide cross-linking via L-cystine Biological Process
GO:0019253 reductive pentose-phosphate cycle Biological Process
GO:0034605 cellular response to heat Biological Process
GO:0065003 protein-containing complex assembly Biological Process
GO:0070417 cellular response to cold Biological Process
GO:0071454 cellular response to anoxia Biological Process
GO:0080153 negative regulation of reductive pentose-phosphate cycle Biological Process
GO:0005829 cytosol Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009570 chloroplast stroma Cellular Component
KEGG gene cross-reference
ath:AT1G76560
ath:AT2G47400
ath:AT3G62410
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.967
Rank 1 · LXL04_008321 · OH-1004
Mitochondrion0.040
Rank 2 · LXL04_008321 · OH-1004
Cytoplasm0.023
Rank 3 · LXL04_008321 · OH-1004
Nucleus0.018
Rank 4 · LXL04_008321 · OH-1004
Cell membrane0.011
Rank 5 · LXL04_008321 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02672.21CP1263-129 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_008321PF02672.21CP12631292.7e-2176.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9C9K2Arabidopsis thalianaCalvin cycle protein CP12-3, chloroplastic66.667%Swiss-Protweak database homology
Q9LZP9Arabidopsis thalianaCalvin cycle protein CP12-2, chloroplastic45.714%Swiss-Protweak database homology
O22914Arabidopsis thalianaCalvin cycle protein CP12-1, chloroplastic47.143%Swiss-Protweak database homology

JBrowse

View in Genome Browser