LXL04_008231 | RubberDandelionOmics

Gene overview

LXL04_008231

Reference: OH-1004 Chr: Chr02 Coordinates: 93362840-93365628 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2121 bp · LXL04_008231|LXL04_008231|OH1004|cDNA

ATGGAGGGATTTGGGGAATTCAATTTGGTACGGGAAAGCTCTGAAGGAAACGGTAATAGAAGGTTTGTAGAAGAAGCATTTGAATCCGGGTATGGCACCAATGAGTTCTTGGAAGTCACTTCTAGTGACACACAAGAAATTGACCATGATTCTTCATCCACTACACGTAGGGGACACAAGCAACGCCATACTCCATATCAGATTCAAGAACTCGAAAAGTCATTTAACGAAAACCCTCACCCTGGTGAGAGTGCAAGGTT...

CDS

Download CDS FASTA

2121 bp · LXL04_008231|LXL04_008231|OH1004|CDS

ATGGAGGGATTTGGGGAATTCAATTTGGTACGGGAAAGCTCTGAAGGAAACGGTAATAGAAGGTTTGTAGAAGAAGCATTTGAATCCGGGTATGGCACCAATGAGTTCTTGGAAGTCACTTCTAGTGACACACAAGAAATTGACCATGATTCTTCATCCACTACACGTAGGGGACACAAGCAACGCCATACTCCATATCAGATTCAAGAACTCGAAAAGTCATTTAACGAAAACCCTCACCCTGGTGAGAGTGCAAGGTT...

Protein

Download Protein FASTA

706 aa · LXL04_008231|LXL04_008231|OH1004|PROTEIN

MEGFGEFNLVRESSEGNGNRRFVEEAFESGYGTNEFLEVTSSDTQEIDHDSSSTTRRGHKQRHTPYQIQELEKSFNENPHPGESARLEIGRKLNLEQNQVKFWFQNKRTQMKNQKDRHGNTILKQENEQLLLENIVLKDALEKKMCKDCGGPTLQIDRSTLEQELTIENAKLKEEINRTTSVLSGRHSSSSPGGGLNPIDSGLQLQIGIVDNNLVSNDPPLVPTASGSESTTGMVAARYLKLASSAMDELMKLAQVDAPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008231`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008231

Location Chr02:93362840-93365628 (-)

Description Similar to HDG1: Homeobox-leucine zipper protein HDG1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61150`	Probable transcription factor (By similarity).	CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis.2011 · DOI: 10.1105/tpc.111.088625 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211
`At4g00730`	Probable transcription factor involved in the regulation of the tissue-specific accumulation of anthocyanins and in cellular organization of the primary root.	ANTHOCYANINLESS2, a homeobox gene affecting anthocyanin distribution and root development in Arabidopsis.1999 · DOI: 10.1105/tpc.11.7.1217
`At4g04890`	Probable transcription factor that binds to the L1 box DNA sequence 5'-TAAATG[CT]A-3'.	Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0674800`	Probable transcription factor.	No verified direct reference in this release
`Os04g0569100`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008231 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0009845 seed germination Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0030154 cell differentiation Biological Process

GO:0043481 anthocyanin accumulation in tissues in response to UV light Biological Process

GO:0048364 root development Biological Process

GO:0048497 maintenance of floral organ identity Biological Process

GO:0048765 root hair cell differentiation Biological Process

GO:0048825 cotyledon development Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

KEGG gene cross-reference

ath:AT3G61150

ath:AT4G00730

ath:AT4G04890

dosa:Os02g0674800

dosa:Os04g0569100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.908

Rank 1 · LXL04_008231 · OH-1004

Cytoplasm0.138

Rank 2 · LXL04_008231 · OH-1004

Cell membrane0.044

Rank 3 · LXL04_008231 · OH-1004

Endoplasmic reticulum0.025

Rank 4 · LXL04_008231 · OH-1004

Plastid0.022

Rank 5 · LXL04_008231 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046.36Homeodomain58-113 aa

PF01852.26START243-458 aa

PF25797.2PDF2_C478-699 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008231	`PF00046.36`	Homeodomain	58	113	3.9e-18	65.7
LXL04_008231	`PF01852.26`	START	243	458	1.9e-33	116.3
LXL04_008231	`PF25797.2`	PDF2_C	478	699	7.2e-47	160.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2E8`	Arabidopsis thaliana	Homeobox-leucine zipper protein HDG1	42.210%	Swiss-Prot	moderate database homology
`Q0WV12`	Arabidopsis thaliana	Homeobox-leucine zipper protein ANTHOCYANINLESS 2	41.399%	Swiss-Prot	moderate database homology
`Q93V99`	Arabidopsis thaliana	Homeobox-leucine zipper protein PROTODERMAL FACTOR 2	37.741%	Swiss-Prot	moderate database homology
`Q6EPF0`	Oryza sativa subsp. japonica	Homeobox-leucine zipper protein ROC5	39.357%	Swiss-Prot	moderate database homology
`Q7Y0V9`	Oryza sativa subsp. japonica	Homeobox-leucine zipper protein ROC4	40.563%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card