LXL04_008171 | RubberDandelionOmics

Gene overview

LXL04_008171

Reference: OH-1004 Chr: Chr02 Coordinates: 90761863-90763249 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_008171|LXL04_008171|OH1004|cDNA

ATGTCAGGAATGGAACGGCTACAGAGGATGTTCGCCGGCGCAGGCGGCGCACTAGGTCATCCACCACCGGACTCTCCGACTCTCGATACATCGGAGCAAGTTTACATCTCCTCCCTAGCCCTCCTCAAGATGCTTAAACACGGGAGAGCGGGAGTTCCCATGGAAGTTATGGGACTGATGCTCGGGGAATTCGTGGATGAGTATACGGTTCGTGTGGTGGATGTTTTTGCTATGCCGCAGAGTGGTACTGGTGTTAGTGT...

CDS

Download CDS FASTA

939 bp · LXL04_008171|LXL04_008171|OH1004|CDS

ATGTCAGGAATGGAACGGCTACAGAGGATGTTCGCCGGCGCAGGCGGCGCACTAGGTCATCCACCACCGGACTCTCCGACTCTCGATACATCGGAGCAAGTTTACATCTCCTCCCTAGCCCTCCTCAAGATGCTTAAACACGGGAGAGCGGGAGTTCCCATGGAAGTTATGGGACTGATGCTCGGGGAATTCGTGGATGAGTATACGGTTCGTGTGGTGGATGTTTTTGCTATGCCGCAGAGTGGTACTGGTGTTAGTGT...

Protein

Download Protein FASTA

312 aa · LXL04_008171|LXL04_008171|OH1004|PROTEIN

MSGMERLQRMFAGAGGALGHPPPDSPTLDTSEQVYISSLALLKMLKHGRAGVPMEVMGLMLGEFVDEYTVRVVDVFAMPQSGTGVSVEAVDHVFQTNMLDMLKQTGRPEMVVGWYHSHPGFGCWLSGVDINTQQSFEALNQRAVAVVVDPIQSVKGKVVIDAFRLINPQTMMLGQEPRQTTSNLGHLNKPSIQALIHGLNRHYYSIAINYRKNKLEEKMLLNLHKKKWTDGLTLERFDTHSKTNEQTVEEMLGLAVKYNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008171`
TK1151 ID	TkA02G434070
OH-1004 ID	LXL04_008171
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008171

Location Chr02:90761863-90763249 (-)

Description Similar to RPN11: 26S proteasome non-ATPase regulatory subunit 14 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23540`	Metalloprotease component of the 26S proteasome that specifically cleaves 'Lys-63'-linked polyubiquitin chains.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008171 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006914 autophagy Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045471 response to ethanol Biological Process

KEGG gene cross-reference

ath:AT5G23540

dme:Dmel_CG18174

hsa:10213

mmu:59029

spo:2543040

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.567

Rank 1 · LXL04_008171 · OH-1004

Nucleus0.440

Rank 2 · LXL04_008171 · OH-1004

Golgi apparatus0.087

Rank 3 · LXL04_008171 · OH-1004

Cell membrane0.080

Rank 4 · LXL04_008171 · OH-1004

Lysosome / Vacuole0.076

Rank 5 · LXL04_008171 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01398.27JAB30-141 aa

PF14464.12Prok-JAB41-131 aa

PF23594.2RPN11_C231-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008171	`PF01398.27`	JAB	30	141	7.3e-35	120.0
LXL04_008171	`PF14464.12`	Prok-JAB	41	131	1.1e-06	29.2
LXL04_008171	`PF23594.2`	RPN11_C	231	310	2.3e-34	117.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT08`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 14 homolog	94.822%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card