LXL04_007922 | RubberDandelionOmics

Gene overview

LXL04_007922

Reference: OH-1004 Chr: Chr02 Coordinates: 74907497-74910987 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2187 bp · LXL04_007922|LXL04_007922|OH1004|cDNA

ATGTCAAAGGCTACTCATTGCTTTTGCCATCTTAATGTCAAGGACGCCAGTCGAACATATGAGGGACCTGGCACGTTACAGCAATTTAAGGTAGAAGAGCCGATTTCACGTTCACCAGAATCATTGGCTACAAGGGATTTCTCAGCTAGTGGTATTTCCTCTCGAACTGGTACCGGAGATTGGGATTCAAAATTCGAAGATGCTCAAGTGGATGAAGCTGAATCCACTCTTAAAGAAGCCCTTTCCCTGAACTATGAGGA...

CDS

Download CDS FASTA

2187 bp · LXL04_007922|LXL04_007922|OH1004|CDS

ATGTCAAAGGCTACTCATTGCTTTTGCCATCTTAATGTCAAGGACGCCAGTCGAACATATGAGGGACCTGGCACGTTACAGCAATTTAAGGTAGAAGAGCCGATTTCACGTTCACCAGAATCATTGGCTACAAGGGATTTCTCAGCTAGTGGTATTTCCTCTCGAACTGGTACCGGAGATTGGGATTCAAAATTCGAAGATGCTCAAGTGGATGAAGCTGAATCCACTCTTAAAGAAGCCCTTTCCCTGAACTATGAGGA...

Protein

Download Protein FASTA

728 aa · LXL04_007922|LXL04_007922|OH1004|PROTEIN

MSKATHCFCHLNVKDASRTYEGPGTLQQFKVEEPISRSPESLATRDFSASGISSRTGTGDWDSKFEDAQVDEAESTLKEALSLNYEEARALLGRLEYQRGNFDAALQVFYGIDIRSLSPRMIKAISDRTLQQNSKPKRENSVVGVMSLHSVSLLLEAILLKAKSLQEMERFKEAAKECKMILDIVESALPTGIPDSIAQDCKLQEMFHKALELLPKLWIEAGLLNEAIIAYRRALVNPWNLDPQRLSTLQKDLAAVLLYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007922`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007922

Location Chr02:74907497-74910987 (-)

Description Similar to NPGR1: Protein NPGR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27460`	Protein NPGR1.	No verified direct reference in this release
`At2g43040`	Calmodulin-binding protein essential for pollen germination, but not necessary for microsporogenesis or gametogenesis.	A calmodulin-binding protein from Arabidopsis has an essential role in pollen germination.2003 · DOI: 10.1073/pnas.1734110100
`At4g28600`	Protein NPGR2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007922 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0009846 pollen germination Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009898 cytoplasmic side of plasma membrane Cellular Component

GO:0098857 membrane microdomain Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G27460

ath:AT2G43040

ath:AT4G28600

hsa:145567

mmu:104718

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.474

Rank 1 · LXL04_007922 · OH-1004

Nucleus0.388

Rank 2 · LXL04_007922 · OH-1004

Cell membrane0.082

Rank 3 · LXL04_007922 · OH-1004

Golgi apparatus0.075

Rank 4 · LXL04_007922 · OH-1004

Endoplasmic reticulum0.071

Rank 5 · LXL04_007922 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13432.13TPR_1666-111 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007922	`PF13432.13`	TPR_16	66	111	7.7e-11	42.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CB03`	Arabidopsis thaliana	Protein NPGR1	57.992%	Swiss-Prot	strong database homology
`Q8GZN1`	Arabidopsis thaliana	Protein NPG1	41.350%	Swiss-Prot	moderate database homology
`Q66GN3`	Arabidopsis thaliana	Protein NPGR2	40.586%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card