LXL04_007683 | RubberDandelionOmics

Gene overview

LXL04_007683

Reference: OH-1004 Chr: Chr02 Coordinates: 56079293-56083339 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2823 bp · LXL04_007683|LXL04_007683|OH1004|cDNA

ATGGCTTTATGTTCATGCCACTTGGTGATTATCGACATGAATCGAACATCTCCAGTTCTACATACCGTAACCCCCAAACACCATCCACTCGAGCTTCAACGATTCAGAGAACCAAATAATTCCGTAGGGTTTTTGACCAAGTGCCGGATACCTGCACGACGTCGTCTGACTGTGGTTGTTGCTGCTGGGGCGGAGCTCTCGAATCCTTTCTCCGTCAACATTGGCTTGGATTCTCAGACATACCAGTCCCATAATCTGAC...

CDS

Download CDS FASTA

2823 bp · LXL04_007683|LXL04_007683|OH1004|CDS

ATGGCTTTATGTTCATGCCACTTGGTGATTATCGACATGAATCGAACATCTCCAGTTCTACATACCGTAACCCCCAAACACCATCCACTCGAGCTTCAACGATTCAGAGAACCAAATAATTCCGTAGGGTTTTTGACCAAGTGCCGGATACCTGCACGACGTCGTCTGACTGTGGTTGTTGCTGCTGGGGCGGAGCTCTCGAATCCTTTCTCCGTCAACATTGGCTTGGATTCTCAGACATACCAGTCCCATAATCTGAC...

Protein

Download Protein FASTA

940 aa · LXL04_007683|LXL04_007683|OH1004|PROTEIN

MALCSCHLVIIDMNRTSPVLHTVTPKHHPLELQRFREPNNSVGFLTKCRIPARRRLTVVVAAGAELSNPFSVNIGLDSQTYQSHNLTQLPWVGPLPGDIAEVEAYCRIFRAAERLHNALMDTLCNPVTGECSVSYAFPSEDKPLLEDKIVSVLGCMICLLNKGREDLLSGRSTIMKSFTVSDVDIMEDKLPPLAIFRREMKRYCESLHIALEIFLTPDDSRSLDVWRKLQRLKSVCYDSGLPRGEDYPPSSLFANWNPVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007683`
TK1151 ID	TkA03G205020
OH-1004 ID	LXL04_007683
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 99.823 / OH-1004 59.894 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007683

Location Chr02:56079293-56083339 (+)

Description Similar to NADK2: NAD kinase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g21640`	Involved in chlorophyll synthesis and chloroplast protection against oxidative damage.	NADK2, an Arabidopsis chloroplastic NAD kinase, plays a vital role in both chlorophyll synthesis and chloroplast protection.2005 · DOI: 10.1007/s11103-005-6802-y
`At3g21070`	Phosphorylates both NAD(+) and NADH, with a twofold preference for NADH.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0191400`	Involved in chlorophyll synthesis and chloroplast protection against oxidative damage.	No verified direct reference in this release
`Os01g0957000`	Probable NAD kinase 1.	No verified direct reference in this release
`Os05g0388400`	Putative NAD kinase 3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007683 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006741 NADP+ biosynthetic process Biological Process

GO:0019674 NAD+ metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003951 NAD+ kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042736 NADH kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G21640

ath:AT3G21070

dosa:Os01g0957000

dosa:Os11g0191400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.889

Rank 1 · LXL04_007683 · OH-1004

Cytoplasm0.068

Rank 2 · LXL04_007683 · OH-1004

Nucleus0.066

Rank 3 · LXL04_007683 · OH-1004

Mitochondrion0.055

Rank 4 · LXL04_007683 · OH-1004

Cell membrane0.051

Rank 5 · LXL04_007683 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22741.2PTP-NADK248-388 aa

PF22785.2Tc-R-P279-376 aa

PF01513.27NAD_kinase643-753 aa

PF20143.5NAD_kinase_C787-913 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007683	`PF22741.2`	PTP-NADK	248	388	4.2e-60	202.6
LXL04_007683	`PF22785.2`	Tc-R-P	279	376	1.1e-08	36.3
LXL04_007683	`PF01513.27`	NAD_kinase	643	753	3.9e-16	60.3
LXL04_007683	`PF20143.5`	NAD_kinase_C	787	913	3.9e-36	124.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5W3`	Arabidopsis thaliana	NAD kinase 2, chloroplastic	62.287%	Swiss-Prot	strong database homology
`Q56YN3`	Arabidopsis thaliana	NAD(H) kinase 1	44.172%	Swiss-Prot	weak database homology
`Q53NI2`	Oryza sativa subsp. japonica	Probable NAD kinase 2, chloroplastic	60.551%	Swiss-Prot	strong database homology
`Q5JK52`	Oryza sativa subsp. japonica	Probable NAD kinase 1	45.679%	Swiss-Prot	weak database homology
`Q60E60`	Oryza sativa subsp. japonica	Putative NAD kinase 3	45.062%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card