LXL04_007669 | RubberDandelionOmics

Gene overview

LXL04_007669

Reference: OH-1004 Chr: Chr02 Coordinates: 55694062-55695000 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

642 bp · LXL04_007669|LXL04_007669|OH1004|cDNA

ATGTCTATTGTCTTTTCTCACCCTAAATCACTCGAAATTCTGCTTCCACCAGACATTTTTAAAGCCCGCAGCCTAAACTGCCACATTCTGAATCCTTTTTGCCATCGAATAAAAGACAAAGCGGATTATGCAAAGAGAGTGATGTGCTTAGCTAATGCAATTGACAGGTTGCCGATTTCAGATAGCCAGACTGATGATACAACAGGCGAGGAGCTCTCACCTGAGTTGTCGAATAGGTATATACGGGGCTTATGTAAGGC...

CDS

Download CDS FASTA

642 bp · LXL04_007669|LXL04_007669|OH1004|CDS

ATGTCTATTGTCTTTTCTCACCCTAAATCACTCGAAATTCTGCTTCCACCAGACATTTTTAAAGCCCGCAGCCTAAACTGCCACATTCTGAATCCTTTTTGCCATCGAATAAAAGACAAAGCGGATTATGCAAAGAGAGTGATGTGCTTAGCTAATGCAATTGACAGGTTGCCGATTTCAGATAGCCAGACTGATGATACAACAGGCGAGGAGCTCTCACCTGAGTTGTCGAATAGGTATATACGGGGCTTATGTAAGGC...

Protein

Download Protein FASTA

213 aa · LXL04_007669|LXL04_007669|OH1004|PROTEIN

MSIVFSHPKSLEILLPPDIFKARSLNCHILNPFCHRIKDKADYAKRVMCLANAIDRLPISDSQTDDTTGEELSPELSNRYIRGLCKAGNIDRAMVYLSQMEALCGLCEQTVKVLQLMEHEGMEPNLIMLNVLINAFGIAGRHLEALSVYHHINESGVSPDVVTYTTLMKALLRAKEFKKVPVIYKDMETAGCSPDRKARELLQTAMMVLERRR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007669`
TK1151 ID	TkA03G203410
OH-1004 ID	LXL04_007669
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007669

Location Chr02:55694062-55695000 (+)

Description Similar to At5g36300: Putative pentatricopeptide repeat-containing protein At5g36300

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42310`	Required for chloroplast protein synthesis and accumulation of subunits of the thylakoid protein complexes.	CRP1 Protein: (dis)similarities between Arabidopsis thaliana and Zea mays.2017 · DOI: 10.3389/fpls.2017.00163
`At5g36300`	Putative pentatricopeptide repeat-containing protein At5g36300.	No verified direct reference in this release
`At5g39710`	Pentatricopeptide repeat-containing protein At5g39710.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0548300`	Required for the processing and translation of chloroplast mRNAs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007669 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010239 chloroplast mRNA processing Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0042651 thylakoid membrane Cellular Component

GO:0003727 single-stranded RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G36300

ath:AT5G42310

dosa:Os07g0548300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.820

Rank 1 · LXL04_007669 · OH-1004

Mitochondrion0.135

Rank 2 · LXL04_007669 · OH-1004

Nucleus0.041

Rank 3 · LXL04_007669 · OH-1004

Cytoplasm0.019

Rank 4 · LXL04_007669 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_007669 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12854.14PPR_181-101 aa

PF23276.3TPR_24110-175 aa

PF13041.13PPR_2124-172 aa

PF13812.13PPR_3148-195 aa

PF13041.13PPR_2159-196 aa

PF01535.27PPR162-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007669	`PF12854.14`	PPR_1	81	101	1.8e-15	57.1
LXL04_007669	`PF23276.3`	TPR_24	110	175	3.7e-08	34.1
LXL04_007669	`PF13041.13`	PPR_2	124	172	2e-23	82.9
LXL04_007669	`PF13812.13`	PPR_3	148	195	2.3e-13	50.7
LXL04_007669	`PF13041.13`	PPR_2	159	196	2e-23	82.9
LXL04_007669	`PF01535.27`	PPR	162	192	5.1e-16	58.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L844`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g42310, chloroplastic	51.402%	Swiss-Prot	moderate database homology
`Q9FFZ2`	Arabidopsis thaliana	Putative pentatricopeptide repeat-containing protein At5g36300	65.169%	Swiss-Prot	weak database homology
`Q9FIX3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g39710	30.827%	Swiss-Prot	moderate database homology
`Q84ZD2`	Oryza sativa subsp. japonica	Pentatricopeptide repeat-containing protein CRP1 homolog, chloroplastic	49.541%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card