LXL04_007579 | RubberDandelionOmics

Gene overview

LXL04_007579

Reference: OH-1004 Chr: Chr02 Coordinates: 52945004-52948343 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2061 bp · LXL04_007579|LXL04_007579|OH1004|cDNA

ATGTCTAACCCTATACCGGTGAACATAATCTCCGACGACGACACAACCCCACTTCAGTTTAAATCCAAGAAACAAAGAATTAGTTTTGATTCAAACTCTACGACAGTCTTCATCATCGATGACGAACCAACTCCTCGCAAGCCATCGCCAAGTCCCTGCACTGCTTCGACGCCTTCGGTCGTACCCGAGACGCCCTCAGTTGCAACAGAGACGCCTTCAGTCGTACCAGAGACGCCCATGGTGGAATCCCCGAAATCATA...

CDS

Download CDS FASTA

2061 bp · LXL04_007579|LXL04_007579|OH1004|CDS

ATGTCTAACCCTATACCGGTGAACATAATCTCCGACGACGACACAACCCCACTTCAGTTTAAATCCAAGAAACAAAGAATTAGTTTTGATTCAAACTCTACGACAGTCTTCATCATCGATGACGAACCAACTCCTCGCAAGCCATCGCCAAGTCCCTGCACTGCTTCGACGCCTTCGGTCGTACCCGAGACGCCCTCAGTTGCAACAGAGACGCCTTCAGTCGTACCAGAGACGCCCATGGTGGAATCCCCGAAATCATA...

Protein

Download Protein FASTA

686 aa · LXL04_007579|LXL04_007579|OH1004|PROTEIN

MSNPIPVNIISDDDTTPLQFKSKKQRISFDSNSTTVFIIDDEPTPRKPSPSPCTASTPSVVPETPSVATETPSVVPETPMVESPKSYVPIVRCSISVSDPQPRFSSSPNPKPSGLICLESDEECEGFGSFPEKINDRSSLTLEVENILEVPSTCSKSSMLHDRSFISPILEDELPQVSDHCGEEDDILDSKTTTKGNNVNKKRSDGELAGKSNEEKDQKESLKGVPLVRCNNSVSSSNPKSSGLICLESDEESEGFERFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007579`
TK1151 ID	TkA03G192150
OH-1004 ID	LXL04_007579
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007579

Location Chr02:52945004-52948343 (-)

Description Similar to EME1B: Crossover junction endonuclease EME1B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22140`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846
`At2g21800`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0648700`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007579 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000712 resolution of meiotic recombination intermediates Biological Process

GO:0006281 DNA repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0009411 response to UV Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0031297 replication fork processing Biological Process

GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process

GO:0051301 cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0048476 Holliday junction resolvase complex Cellular Component

KEGG gene cross-reference

ath:AT2G21800

ath:AT2G22140

dosa:Os04g0648700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.933

Rank 1 · LXL04_007579 · OH-1004

Cytoplasm0.164

Rank 2 · LXL04_007579 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_007579 · OH-1004

Cell membrane0.020

Rank 4 · LXL04_007579 · OH-1004

Endoplasmic reticulum0.008

Rank 5 · LXL04_007579 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02732.22ERCC4391-547 aa

PF21292.4EME1-MUS81_C588-659 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007579	`PF02732.22`	ERCC4	391	547	4e-14	53.4
LXL04_007579	`PF21292.4`	EME1-MUS81_C	588	659	1.6e-09	38.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C5H8J1`	Arabidopsis thaliana	Crossover junction endonuclease EME1B	61.732%	Swiss-Prot	moderate database homology
`Q84M98`	Arabidopsis thaliana	Crossover junction endonuclease EME1A	54.522%	Swiss-Prot	moderate database homology
`Q0J9J6`	Oryza sativa subsp. japonica	Crossover junction endonuclease EME1	51.613%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card