LXL04_007570 | RubberDandelionOmics

Gene overview

LXL04_007570

Reference: OH-1004 Chr: Chr02 Coordinates: 52473731-52478191 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2436 bp · LXL04_007570|LXL04_007570|OH1004|cDNA

ATGTATGTGGTGAAGAGAGATGGGCGTCAAGAGACTGTGCATTTTGATAAAATCACTGCCCGATTGAAGAAACTCAGTTATGGACTTAGTATTGAGCACTGTGACCCGGTGCTTGTTTCCCAGAAGGTGTGTGCTGGTGTTTACAAGGGTGTCACCACCAGTCAGCTTGATGAACTTGCCGCGGAAACCGCCGCTGCACTGACTGCCAACCATCCCGACTATGCTTCCTTGGCTGCAAGGATTGTCGTTTCAAATCTGCA...

CDS

Download CDS FASTA

2436 bp · LXL04_007570|LXL04_007570|OH1004|CDS

ATGTATGTGGTGAAGAGAGATGGGCGTCAAGAGACTGTGCATTTTGATAAAATCACTGCCCGATTGAAGAAACTCAGTTATGGACTTAGTATTGAGCACTGTGACCCGGTGCTTGTTTCCCAGAAGGTGTGTGCTGGTGTTTACAAGGGTGTCACCACCAGTCAGCTTGATGAACTTGCCGCGGAAACCGCCGCTGCACTGACTGCCAACCATCCCGACTATGCTTCCTTGGCTGCAAGGATTGTCGTTTCAAATCTGCA...

Protein

Download Protein FASTA

811 aa · LXL04_007570|LXL04_007570|OH1004|PROTEIN

MYVVKRDGRQETVHFDKITARLKKLSYGLSIEHCDPVLVSQKVCAGVYKGVTTSQLDELAAETAAALTANHPDYASLAARIVVSNLHKNTKKSFSETIKEMYAHISDRSGQKAPLIADDVYEIIMKHAAKLDSEIIYDRDFDYDYFGFKTLERSYLLKIEGNVVERPQHMLMRVAVGIHKEDIDSVIKTYHLMSQRWFTHASPTLFNAGTPRPQLSSCFLICMKDDSIEGIYDTLKECAVISKSAGGIGVSVHNIRSTGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007570`
TK1151 ID	TkA03G190820
OH-1004 ID	LXL04_007570
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007570

Location Chr02:52473731-52478191 (-)

Description Similar to RNR1: Ribonucleoside-diphosphate reductase large subunit

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g21790`	Provides the precursors necessary for DNA synthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007570 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006260 DNA replication Biological Process

GO:0006264 mitochondrial DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0009185 ribonucleoside diphosphate metabolic process Biological Process

GO:0009202 deoxyribonucleoside triphosphate biosynthetic process Biological Process

GO:0009263 deoxyribonucleotide biosynthetic process Biological Process

GO:0009265 2'-deoxyribonucleotide biosynthetic process Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0051290 protein heterotetramerization Biological Process

GO:0070318 positive regulation of G0 to G1 transition Biological Process

GO:1900087 positive regulation of G1/S transition of mitotic cell cycle Biological Process

KEGG gene cross-reference

ath:AT2G21790

hsa:6240

mmu:20133

pon:100172956

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.802

Rank 1 · LXL04_007570 · OH-1004

Nucleus0.270

Rank 2 · LXL04_007570 · OH-1004

Mitochondrion0.062

Rank 3 · LXL04_007570 · OH-1004

Cell membrane0.054

Rank 4 · LXL04_007570 · OH-1004

Lysosome / Vacuole0.044

Rank 5 · LXL04_007570 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03477.22ATP-cone1-88 aa

PF00317.27Ribonuc_red_lgN142-212 aa

PF02867.21Ribonuc_red_lgC216-757 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007570	`PF03477.22`	ATP-cone	1	88	5e-14	53.3
LXL04_007570	`PF00317.27`	Ribonuc_red_lgN	142	212	1.2e-26	93.2
LXL04_007570	`PF02867.21`	Ribonuc_red_lgC	216	757	5.6e-219	728.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJ20`	Arabidopsis thaliana	Ribonucleoside-diphosphate reductase large subunit	85.172%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card