LXL04_007569 | RubberDandelionOmics

Gene overview

LXL04_007569

Reference: OH-1004 Chr: Chr02 Coordinates: 52453815-52455992 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

816 bp · LXL04_007569|LXL04_007569|OH1004|cDNA

ATGGCGACAAGGCTTGTTCATACTCAAATCCCAACCTCCCACGTGCTTCCTTTTTCAATACCATCTCCACCAAAGATGGCCAGAAGTCATACTCAAAGGCCGAATCACTCAATCCTAATAAATTTTCTCCTGCCTAAATCAAAGTTCGCCACTAAAGTTGCAGAACCAAGCTCTAGCTTAGTAGGCAATGAAGAAGACGAAGTAGAGATAGCAACCGATGAGCGTCCAACAGATTGTTGTGCGCGAGTCAAAACTGAAAT...

CDS

Download CDS FASTA

816 bp · LXL04_007569|LXL04_007569|OH1004|CDS

ATGGCGACAAGGCTTGTTCATACTCAAATCCCAACCTCCCACGTGCTTCCTTTTTCAATACCATCTCCACCAAAGATGGCCAGAAGTCATACTCAAAGGCCGAATCACTCAATCCTAATAAATTTTCTCCTGCCTAAATCAAAGTTCGCCACTAAAGTTGCAGAACCAAGCTCTAGCTTAGTAGGCAATGAAGAAGACGAAGTAGAGATAGCAACCGATGAGCGTCCAACAGATTGTTGTGCGCGAGTCAAAACTGAAAT...

Protein

Download Protein FASTA

271 aa · LXL04_007569|LXL04_007569|OH1004|PROTEIN

MATRLVHTQIPTSHVLPFSIPSPPKMARSHTQRPNHSILINFLLPKSKFATKVAEPSSSLVGNEEDEVEIATDERPTDCCARVKTEINSALEGYNRGIFGIPSEKKCEIENMVKVLESLNPTPHPTLDLNKLGGCWKLIYSTITILGSRRTKLGLRDFISLGDFLQIIDISKGKAVNEIMFNVRGLNLFSGKLIIEASFKISSKSRVDISYNTSTIIPDQLMNMFRKNYDILLGIFNPDGWLEITYVDDTLRIGRDDKGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007569`
TK1151 ID	TkA03G190770
OH-1004 ID	LXL04_007569
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007569

Location Chr02:52453815-52455992 (+)

Description Similar to FBN5: Fibrillin-5, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09820`	Essential for plastoquinone-9 (PQ-9) biosynthesis.	Fibrillin 5 Is Essential for Plastoquinone-9 Biosynthesis by Binding to Solanesyl Diphosphate Synthases in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00707 Functional Role of Fibrillin5 in Acclimation to Photooxidative Stress.2018 · DOI: 10.1093/pcp/pcy093

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0422000`	Essential for plastoquinone-9 (PQ-9) biosynthesis through its interaction with the solanesyl diphosphate synthase SPS2.	Conserved Function of Fibrillin5 in the Plastoquinone-9 Biosynthetic Pathway in Arabidopsis and Rice.2017 · DOI: 10.3389/fpls.2017.01197
`Os09g0133600`	Probable plastid-lipid-associated protein 2, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007569 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010117 photoprotection Biological Process

GO:0010236 plastoquinone biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009509 chromoplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT5G09820

dosa:Os04g0422000

osa:4335835

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.988

Rank 1 · LXL04_007569 · OH-1004

Mitochondrion0.022

Rank 2 · LXL04_007569 · OH-1004

Cytoplasm0.019

Rank 3 · LXL04_007569 · OH-1004

Nucleus0.017

Rank 4 · LXL04_007569 · OH-1004

Peroxisome0.013

Rank 5 · LXL04_007569 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04755.19PAP_fibrillin82-264 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007569	`PF04755.19`	PAP_fibrillin	82	264	3.7e-33	115.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5M755`	Arabidopsis thaliana	Fibrillin-5, chloroplastic	54.198%	Swiss-Prot	strong database homology
`Q0JD85`	Oryza sativa subsp. japonica	Fibrillin protein 5 homolog	53.226%	Swiss-Prot	strong database homology
`Q6K439`	Oryza sativa subsp. japonica	Probable plastid-lipid-associated protein 2, chloroplastic	29.004%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card