LXL04_007324 | RubberDandelionOmics

Gene overview

LXL04_007324

Reference: OH-1004 Chr: Chr02 Coordinates: 44330739-44331806 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · LXL04_007324|LXL04_007324|OH1004|cDNA

ATGGAATGCTCAATTTTGAAGCTGATAATTGAGAAGGGGCCAAGAGCAGGTGAAAGTCTGGAATATCCATCTGGATCCGTCGTCAAAATTGGTCGGTTAGTGCGTGGCAATACACTCGGAATCAAAGACGCCGGTATCTCCTCCAAACACATTTCCATCGAATTCGATAATGAAGTGAGCAAATGGAATCTCACTGATCTCGATTCTTCAAACGGTACACTTTTGAACGGGACACTGCTAAAGCCTAACGTTCCTTCCAC...

CDS

Download CDS FASTA

1068 bp · LXL04_007324|LXL04_007324|OH1004|CDS

ATGGAATGCTCAATTTTGAAGCTGATAATTGAGAAGGGGCCAAGAGCAGGTGAAAGTCTGGAATATCCATCTGGATCCGTCGTCAAAATTGGTCGGTTAGTGCGTGGCAATACACTCGGAATCAAAGACGCCGGTATCTCCTCCAAACACATTTCCATCGAATTCGATAATGAAGTGAGCAAATGGAATCTCACTGATCTCGATTCTTCAAACGGTACACTTTTGAACGGGACACTGCTAAAGCCTAACGTTCCTTCCAC...

Protein

Download Protein FASTA

355 aa · LXL04_007324|LXL04_007324|OH1004|PROTEIN

MECSILKLIIEKGPRAGESLEYPSGSVVKIGRLVRGNTLGIKDAGISSKHISIEFDNEVSKWNLTDLDSSNGTLLNGTLLKPNVPSTLEDGDCIKIGELTSIIVKIELQSTIPPERYPRRQGKSGPPAAAVESTRSGLGLGLDGDLGENAVEEPVQKRVLRPRGKKVADTNPDFPIERKVTRGRPKKLQVQPSKDPDLDKGEPADIVVPVDGRRTRRGRKALPVEPLEDLHVLVDAASENIVQNSGVKEKLNANNESAQD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007324`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007324

Location Chr02:44330739-44331806 (-)

Description Similar to At4g14490: FHA domain-containing protein At4g14490

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14490`	FHA domain-containing protein At4g14490.	No verified direct reference in this release
`At5g19280`	Dephosphorylates the Ser/Thr receptor-like kinase RLK5.	The Arabidopsis kinase-associated protein phosphatase controls internalization of the somatic embryogenesis receptor kinase 1.2002 · DOI: 10.1101/gad.220402 The Arabidopsis SERK1 protein interacts with the AAA-ATPase AtCDC48, the 14-3-3 protein GF14lambda and the PP2C phosphatase KAPP.2005 · DOI: 10.1007/s00425-004-1447-7 The Arabidopsis kinase-associated protein phosphatase regulates adaptation to Na+ stress.2008 · DOI: 10.1104/pp.107.109009 A possible role for kinase-associated protein phosphatase in the Arabidopsis CLAVATA1 signaling pathway.1997 · DOI: 10.1073/pnas.94.19.10467 Control of meristem development by CLAVATA1 receptor kinase and kinase-associated protein phosphatase interactions 1998 · DOI: 10.1104/pp.117.4.1217

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007324 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001938 positive regulation of endothelial cell proliferation Biological Process

GO:0007155 cell adhesion Biological Process

GO:0007165 signal transduction Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0032133 chromosome passenger complex Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G14490

ath:AT5G19280

hsa:55109

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.954

Rank 1 · LXL04_007324 · OH-1004

Cytoplasm0.110

Rank 2 · LXL04_007324 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_007324 · OH-1004

Endoplasmic reticulum0.015

Rank 4 · LXL04_007324 · OH-1004

Mitochondrion0.010

Rank 5 · LXL04_007324 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16697.11Yop-YscD_cpl12-105 aa

PF00498.32FHA28-97 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007324	`PF16697.11`	Yop-YscD_cpl	12	105	1.2e-08	35.9
LXL04_007324	`PF00498.32`	FHA	28	97	5.4e-14	53.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23305`	Arabidopsis thaliana	FHA domain-containing protein At4g14490	30.250%	Swiss-Prot	moderate database homology
`P46014`	Arabidopsis thaliana	Protein phosphatase 2C 70	31.429%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card