LXL04_007269 | RubberDandelionOmics

Gene overview

LXL04_007269

Reference: OH-1004 Chr: Chr02 Coordinates: 42070750-42072243 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1092 bp · LXL04_007269|LXL04_007269|OH1004|cDNA

ATGGAATCGAATCGTGGAGGATACAATGTACATGCCCATTTCTTGATAACAATAATGCCTTATGACACAATTCCCTCTTACATTCGTCCTCATCATCTCTATACCAATCTTGGAGGTATTACCAATTGCAAGAAAACCCCAAATTTCCCCCAAAATCAGGAACAATCAAACCCTAACAGGCTAACATCACCTCACACACTCCTCGACTTTCCCCTATTTCTTCTCCCAGTCAGTAAATGGATCAATGGAAAACAGGAGCC...

CDS

Download CDS FASTA

1092 bp · LXL04_007269|LXL04_007269|OH1004|CDS

ATGGAATCGAATCGTGGAGGATACAATGTACATGCCCATTTCTTGATAACAATAATGCCTTATGACACAATTCCCTCTTACATTCGTCCTCATCATCTCTATACCAATCTTGGAGGTATTACCAATTGCAAGAAAACCCCAAATTTCCCCCAAAATCAGGAACAATCAAACCCTAACAGGCTAACATCACCTCACACACTCCTCGACTTTCCCCTATTTCTTCTCCCAGTCAGTAAATGGATCAATGGAAAACAGGAGCC...

Protein

Download Protein FASTA

363 aa · LXL04_007269|LXL04_007269|OH1004|PROTEIN

MESNRGGYNVHAHFLITIMPYDTIPSYIRPHHLYTNLGGITNCKKTPNFPQNQEQSNPNRLTSPHTLLDFPLFLLPVSKWINGKQEPNCTYNNNINISPSPIPSKGLETTEVEVKDTNDARKVQKADREKLRRDRLNEQFIELGHILDPDRPKNDKASIIIDTIQVLKDLTTEVTRLKSECAALSEESSELTQEKNELREEKSSLKSDIENLNTLYQQRVGVMYPWGTIDHPSVVNVMPPPYSFPVALPVPTGPLPMHPF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007269`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007269

Location Chr02:42070750-42072243 (-)

Description Similar to BHLH121: Transcription factor bHLH121

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19860`	Transcription factor bHLH121.	No verified direct reference in this release
`At4g36060`	Transcription factor bHLH11.	No verified direct reference in this release
`At5g54680`	Transcription factor.	An Arabidopsis basic helix-loop-helix leucine zipper protein modulates metal homeostasis and auxin conjugate responsiveness.2006 · DOI: 10.1534/genetics.106.061044

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0379300`	Transcription factor that acts as a negative regulator of the iron deficiency response.	Identification of a novel iron regulated basic helix-loop-helix protein involved in Fe homeostasis in Oryza sativa.2010 · DOI: 10.1186/1471-2229-10-166
`Os07g0628500`	Transcription factor that plays a positive role in salt stress tolerance.	OsJAZ9 acts as a transcriptional regulator in jasmonate signaling and modulates salt stress tolerance in rice.2015 · DOI: 10.1016/j.plantsci.2014.12.010

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007269 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0010039 response to iron ion Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

GO:1990837 sequence-specific double-stranded DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G19860

ath:AT4G36060

ath:AT5G54680

dosa:Os03g0379300

dosa:Os07g0628500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956

Rank 1 · LXL04_007269 · OH-1004

Cytoplasm0.133

Rank 2 · LXL04_007269 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_007269 · OH-1004

Endoplasmic reticulum0.015

Rank 4 · LXL04_007269 · OH-1004

Plastid0.009

Rank 5 · LXL04_007269 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH121-170 aa

PF23177.2bHLH_IRO3122-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007269	`PF00010.32`	HLH	121	170	3.5e-07	30.7
LXL04_007269	`PF23177.2`	bHLH_IRO3	122	208	8.8e-28	97.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT23`	Arabidopsis thaliana	Transcription factor bHLH121	48.913%	Swiss-Prot	moderate database homology
`Q8W2F2`	Arabidopsis thaliana	Transcription factor bHLH11	43.069%	Swiss-Prot	moderate database homology
`Q9FH37`	Arabidopsis thaliana	Transcription factor ILR3	37.888%	Swiss-Prot	weak database homology
`Q10KL8`	Oryza sativa subsp. japonica	Protein IRON-RELATED TRANSCRIPTION FACTOR 3	39.706%	Swiss-Prot	weak database homology
`Q69V10`	Oryza sativa subsp. japonica	Transcription factor BHLH062	35.211%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card