Gene Card
Gene overview
cDNA / CDS / Protein Sequences
849 bp · LXL04_007171|LXL04_007171|OH1004|cDNA
ATGGTCGTCGCCGGAAGACAAGGCGCTGCCAAATCGCCGAGTGACCGGAATCGCCTGGAGCAGATCGTGTGGTACAGCACTGCCTTTGGGAGGATGGATGCTGTTGGAAGTGGTCGCCGAGAAGAGCCTCAAATCCTAATCACTCCTCCTCGGCCCTCGCCTCCTCCTAGACGCTCAGGCCGCAATCAAGCATCATCGGTCTCCCAGAGTTGTTCTTACTCGACGCACGAAGACGCCACAGAGTCTTTCCTCCTCCTGCT...
849 bp · LXL04_007171|LXL04_007171|OH1004|CDS
ATGGTCGTCGCCGGAAGACAAGGCGCTGCCAAATCGCCGAGTGACCGGAATCGCCTGGAGCAGATCGTGTGGTACAGCACTGCCTTTGGGAGGATGGATGCTGTTGGAAGTGGTCGCCGAGAAGAGCCTCAAATCCTAATCACTCCTCCTCGGCCCTCGCCTCCTCCTAGACGCTCAGGCCGCAATCAAGCATCATCGGTCTCCCAGAGTTGTTCTTACTCGACGCACGAAGACGCCACAGAGTCTTTCCTCCTCCTGCT...
Protein
Download Protein FASTA282 aa · LXL04_007171|LXL04_007171|OH1004|PROTEIN
MVVAGRQGAAKSPSDRNRLEQIVWYSTAFGRMDAVGSGRREEPQILITPPRPSPPPRRSGRNQASSVSQSCSYSTHEDATESFLLLLWHACAGPIVSLRTVAAAICGLLHTLKSNKVTKEKNLSHSISEQAMIEKLLLMLRDPDFRVIFSLARRIGVLFQTWDGHDELFQDILSNFSVKLVVLFKNKLVKANEVLAAGHQPRPRMETIIVTLVHLALHSEKIELEAVFMICVIAAIHSSLRELVAAVLDNLSKKLQYNSR...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_007171 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_007171 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr02:38084823-38086459 (-) | ||||||
| Description | Similar to ATM: Serine/threonine-protein kinase ATM | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0006281 DNA repair Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0006974 DNA damage response Biological Process GO:0007129 homologous chromosome pairing at meiosis Biological Process GO:0008380 RNA splicing Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0010332 response to gamma radiation Biological Process GO:0032204 regulation of telomere maintenance Biological Process GO:0033044 regulation of chromosome organization Biological Process GO:0043247 telomere maintenance in response to DNA damage Biological Process GO:0045003 double-strand break repair via synthesis-dependent strand annealing Biological Process GO:0051321 meiotic cell cycle Biological Process | ||||||
| KEGG gene cross-reference | No functional description available |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q9M3G7 | Arabidopsis thaliana | Serine/threonine-protein kinase ATM | 48.515% | Swiss-Prot | moderate database homology |