LXL04_007049 | RubberDandelionOmics

Gene overview

LXL04_007049

Reference: OH-1004 Chr: Chr02 Coordinates: 34378110-34379649 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1458 bp · LXL04_007049|LXL04_007049|OH1004|cDNA

ATGGAATCCTTACAGCCATTTCCAACCGAAAACGACCTGTCAGAAGCTCGAAAAACCGTACGAGATCTCGCAATCAAGATCGAAAAAACAAACTCAAGAGctcaaaaacaccaaaaacaagaagaaaaccAGGAGGATTCTCAGTACACACAAGTAATGAAAGAAATTGAAACCATGAAACAAGAATTGGGGAAACTGAAGCTCGATATGAAACATGTTTTGAAGGAGAAAAAACATACGGAAAATGGATTCAAAGCCTC...

CDS

Download CDS FASTA

1458 bp · LXL04_007049|LXL04_007049|OH1004|CDS

ATGGAATCCTTACAGCCATTTCCAACCGAAAACGACCTGTCAGAAGCTCGAAAAACCGTACGAGATCTCGCAATCAAGATCGAAAAAACAAACTCAAGAGCTCAAAAACACCAAAAACAAGAAGAAAACCAGGAGGATTCTCAGTACACACAAGTAATGAAAGAAATTGAAACCATGAAACAAGAATTGGGGAAACTGAAGCTCGATATGAAACATGTTTTGAAGGAGAAAAAACATACGGAAAATGGATTCAAAGCCTC...

Protein

Download Protein FASTA

485 aa · LXL04_007049|LXL04_007049|OH1004|PROTEIN

MESLQPFPTENDLSEARKTVRDLAIKIEKTNSRAQKHQKQEENQEDSQYTQVMKEIETMKQELGKLKLDMKHVLKEKKHTENGFKASSSKSSMLSSAVERIKKEIEELDEEQVLVEIARIEAVKELEAIEAQKKEEAIRYQIQLEEIKKKTEQIIQQKASNVNMNSTRDLLHKMNAEKEALEAELEEIKREGFNLMASMDVIRNELKAMQEEMSRLEKEEEKRDLTIETLNAKILKGKLKLESVTSTTEKANSIASNLSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007049`
TK1151 ID	TkA03G105770
OH-1004 ID	LXL04_007049
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007049

Location Chr02:34378110-34379649 (-)

Description Similar to PMI2: Protein PLASTID MOVEMENT IMPAIRED 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66840`	Required for the chloroplast avoidance response under high intensity blue light.	Two interacting coiled-coil proteins, WEB1 and PMI2, maintain the chloroplast photorelocation movement velocity in Arabidopsis.2010 · DOI: 10.1073/pnas.1007836107
`At5g38150`	Required for the chloroplast avoidance response under high intensity blue light.	Plastid movement impaired 2, a new gene involved in normal blue-light-induced chloroplast movements in Arabidopsis.2006 · DOI: 10.1104/pp.106.080333
`At5g55860`	WEB family protein At5g55860.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007049 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007155 cell adhesion Biological Process

GO:0009408 response to heat Biological Process

GO:0009637 response to blue light Biological Process

GO:0009888 tissue development Biological Process

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0016477 cell migration Biological Process

GO:0040017 positive regulation of locomotion Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0051788 response to misfolded protein Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0071711 basement membrane organization Biological Process

KEGG gene cross-reference

ath:AT1G66840

ath:AT5G55860

cel:CELE_K08C7.3

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.653

Rank 1 · LXL04_007049 · OH-1004

Nucleus0.320

Rank 2 · LXL04_007049 · OH-1004

Cell membrane0.133

Rank 3 · LXL04_007049 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_007049 · OH-1004

Plastid0.042

Rank 5 · LXL04_007049 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701.17WEMBL149-401 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007049	`PF05701.17`	WEMBL	149	401	1.2e-13	51.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9N6`	Arabidopsis thaliana	Protein PLASTID MOVEMENT IMPAIRED 2	33.409%	Swiss-Prot	moderate database homology
`Q9FF41`	Arabidopsis thaliana	Protein PLASTID MOVEMENT IMPAIRED 15	31.429%	Swiss-Prot	moderate database homology
`Q9LVQ4`	Arabidopsis thaliana	WEB family protein At5g55860	27.226%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card