LXL04_006876 | RubberDandelionOmics

Gene overview

LXL04_006876

Reference: OH-1004 Chr: Chr02 Coordinates: 28591895-28597776 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

798 bp · LXL04_006876|LXL04_006876|OH1004|cDNA

ATGGCGCAATCAACGAAAACGCGGCTACTTTTAGTGGCTCTCCGGTGCACCAACAAGAACAAGCTTCCCTTGTCGTTTCAGTGCACTAAGCAATGGCGCAATTGGATGAGTTGCAGATACAGTGTCGATGATGCCGTCAAGTGTACCCGCAACAGACTGTTCACAAAAAAACCCAGATCAAAACTCAAAACCAAGCCCCAATTCGTGAATCATTcacaaaagaagaagaaggagaaagagCTCACTGGTGGTGCTGAAAA...

CDS

Download CDS FASTA

798 bp · LXL04_006876|LXL04_006876|OH1004|CDS

ATGGCGCAATCAACGAAAACGCGGCTACTTTTAGTGGCTCTCCGGTGCACCAACAAGAACAAGCTTCCCTTGTCGTTTCAGTGCACTAAGCAATGGCGCAATTGGATGAGTTGCAGATACAGTGTCGATGATGCCGTCAAGTGTACCCGCAACAGACTGTTCACAAAAAAACCCAGATCAAAACTCAAAACCAAGCCCCAATTCGTGAATCATTCACAAAAGAAGAAGAAGGAGAAAGAGCTCACTGGTGGTGCTGAAAA...

Protein

Download Protein FASTA

265 aa · LXL04_006876|LXL04_006876|OH1004|PROTEIN

MAQSTKTRLLLVALRCTNKNKLPLSFQCTKQWRNWMSCRYSVDDAVKCTRNRLFTKKPRSKLKTKPQFVNHSQKKKKEKELTGGAENGNFCPESFRHLHSNVPESTETNNAQFHTGDACPYFKFAHLTANQAIIEATENADKIHIVDFGIVRSGGGRVLKTTSGVDDLITCPKPPKSDGESLTQVSHDVDRCSMEEDKKETCFSGHVVPGHDPIEKSKVVHWKKWDRWGANVYKPTIKHKREAGQNQSEQQSIKTSTKKQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006876`
TK1151 ID	TkA03G085200
OH-1004 ID	LXL04_006876
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	88.100
Protein coverage (%)	TK1151 50.467 / OH-1004 22.264 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006876

Location Chr02:28591895-28597776 (-)

Description Similar to SCL7: SCARECROW-LIKE protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66770`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At3g50650`	Probable transcription factor involved in plant development (Probable).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0723000`	Probable transcription factor involved in plant development (By similarity).	Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa.2016 · DOI: 10.1105/tpc.16.00018

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006876 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009938 negative regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:2000033 regulation of seed dormancy process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G50650

ath:AT5G66770

dosa:Os03g0723000

sly:543881

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.647

Rank 1 · LXL04_006876 · OH-1004

Cytoplasm0.285

Rank 2 · LXL04_006876 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_006876 · OH-1004

Mitochondrion0.070

Rank 4 · LXL04_006876 · OH-1004

Endoplasmic reticulum0.059

Rank 5 · LXL04_006876 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514.21GRAS105-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006876	`PF03514.21`	GRAS	105	151	3.3e-13	50.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FL03`	Arabidopsis thaliana	Scarecrow-like protein 4	83.333%	Swiss-Prot	weak database homology
`Q9SCR0`	Arabidopsis thaliana	Scarecrow-like protein 7	75.000%	Swiss-Prot	weak database homology
`Q53K16`	Oryza sativa subsp. japonica	SCARECROW-LIKE protein 7	83.333%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card