LXL04_006734 | RubberDandelionOmics

Gene overview

LXL04_006734

Reference: OH-1004 Chr: Chr02 Coordinates: 23574268-23575633 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1029 bp · LXL04_006734|LXL04_006734|OH1004|cDNA

ATGCTACTTCACGGGAACTTCTCCCTTCCATTCCGATCACCCCTCCGCCTACGAGTACGACCTCCGATcacccaccaccaccacccacGCAAACTCTCATTCGCAGCAATTTCATCTTCCGCCGGTTTTGCCATCTCCGACCAAGAGCTGGAATCGCGAGGCTTCATCTTCCGCCGCACAATCGAAGACCTGAACTTAGACCACTTAAACTCCGTCTTTGTCGCCGTCGGTTTCCCAAAACGAGACACCGACAAGATAAA...

CDS

Download CDS FASTA

1029 bp · LXL04_006734|LXL04_006734|OH1004|CDS

ATGCTACTTCACGGGAACTTCTCCCTTCCATTCCGATCACCCCTCCGCCTACGAGTACGACCTCCGATCACCCACCACCACCACCCACGCAAACTCTCATTCGCAGCAATTTCATCTTCCGCCGGTTTTGCCATCTCCGACCAAGAGCTGGAATCGCGAGGCTTCATCTTCCGCCGCACAATCGAAGACCTGAACTTAGACCACTTAAACTCCGTCTTTGTCGCCGTCGGTTTCCCAAAACGAGACACCGACAAGATAAA...

Protein

Download Protein FASTA

342 aa · LXL04_006734|LXL04_006734|OH1004|PROTEIN

MLLHGNFSLPFRSPLRLRVRPPITHHHHPRKLSFAAISSSAGFAISDQELESRGFIFRRTIEDLNLDHLNSVFVAVGFPKRDTDKIKVALEHTDSLLWVEYEKTKRPVAFARATGDGVFNAIIWDVVVDPTFQGIGLGKAVIERVVEELLEKGIINIALYSEPRVLGFYRPLGFVSDPEGIRGMVYSRKNKKKYVSGGGRMASSVSSVSGGGRSRRQGIRSRCGCGDLVGSWTCWKSTHPGRRFVGCPNFRKKSCGYFFW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006734`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006734

Location Chr02:23574268-23575633 (+)

Description Similar to SNAT2: Serotonin N-acetyltransferase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26220`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA) and epsilon-lysine acetylation (KA), possibly with a low efficiency or toward specific plastid substrates.	Knockout of Arabidopsis Serotonin N -Acetyltransferase-2 Reduces Melatonin Levels and Delays Flowering.2019 · DOI: 10.3390/biom9110712

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0102000`	Catalyzes the N-acetylation of serotonin into N-acetylserotonin, the penultimate step in the synthesis of melatonin.	Cloning and characterization of the serotonin N-acetyltransferase-2 gene (SNAT2) in rice (Oryza sativa).2016 · DOI: 10.1111/jpi.12339

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006734 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0030187 melatonin biosynthetic process Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004059 aralkylamine N-acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0046982 protein heterodimerization activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26220

dosa:Os08g0102000

syn:sll0286

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.787

Rank 1 · LXL04_006734 · OH-1004

Mitochondrion0.136

Rank 2 · LXL04_006734 · OH-1004

Nucleus0.094

Rank 3 · LXL04_006734 · OH-1004

Cytoplasm0.039

Rank 4 · LXL04_006734 · OH-1004

Peroxisome0.019

Rank 5 · LXL04_006734 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00583.32Acetyltransf_183-174 aa

PF13673.14Acetyltransf_1089-176 aa

PF13508.14Acetyltransf_795-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006734	`PF00583.32`	Acetyltransf_1	83	174	3.3e-12	47.4
LXL04_006734	`PF13673.14`	Acetyltransf_10	89	176	2.3e-06	28.3
LXL04_006734	`PF13508.14`	Acetyltransf_7	95	175	2.8e-09	37.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C666`	Arabidopsis thaliana	GCN5-related N-acetyltransferase 1, chloroplastic	65.327%	Swiss-Prot	moderate database homology
`Q6Z1Y6`	Oryza sativa subsp. japonica	Serotonin N-acetyltransferase 2, chloroplastic	48.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card