LXL04_006703 | RubberDandelionOmics

Gene overview

LXL04_006703

Reference: OH-1004 Chr: Chr02 Coordinates: 22592804-22594404 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

831 bp · LXL04_006703|LXL04_006703|OH1004|cDNA

ATGAGCAGCGGACCAGGCCTCTTCTCCGACATCGGCAGGAAAGCCAACGATCTGTTGACGAGAGACTACCTAACGGATCAGAAACTTTCTGTTTCATCGACCAGTGCAAACGGAGTCGGAATAACATCAACTGCAACAAAGAAAGGCGGTCTGTCATCAGGAGATGTGCGAGCACTCTACAAGTACAACAACATATTGGTTGATGTCAAAGTCGACACAGAATCAAAGATTGCCACAACATTAACTTTCACAGACATCGT...

CDS

Download CDS FASTA

831 bp · LXL04_006703|LXL04_006703|OH1004|CDS

ATGAGCAGCGGACCAGGCCTCTTCTCCGACATCGGCAGGAAAGCCAACGATCTGTTGACGAGAGACTACCTAACGGATCAGAAACTTTCTGTTTCATCGACCAGTGCAAACGGAGTCGGAATAACATCAACTGCAACAAAGAAAGGCGGTCTGTCATCAGGAGATGTGCGAGCACTCTACAAGTACAACAACATATTGGTTGATGTCAAAGTCGACACAGAATCAAAGATTGCCACAACATTAACTTTCACAGACATCGT...

Protein

Download Protein FASTA

276 aa · LXL04_006703|LXL04_006703|OH1004|PROTEIN

MSSGPGLFSDIGRKANDLLTRDYLTDQKLSVSSTSANGVGITSTATKKGGLSSGDVRALYKYNNILVDVKVDTESKIATTLTFTDIVPSTKAITSFKFPDFNSGKVEVQYYHCHANLASAISLNQTPTIDLSATLGTPSFAIGAEAGYEPSSGRFTKYTAGISVNKPEANASIILCDKGDTIKASYIHNLDELKKTAAVGEITRRFSLNENTFTVGGSYAVDNLTMVKGKLNNHGKLGALLQHEIIPKSVVTLSSEMDTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006703`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006703

Location Chr02:22592804-22594404 (-)

Description Similar to VDAC2: Mitochondrial outer membrane protein porin 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67500`	Forms a channel through the mitochondrial outer membrane that allows diffusion of small hydrophilic molecules.	Voltage-dependent anion channel 2 of Arabidopsis thaliana (AtVDAC2) is involved in ABA-mediated early seedling development.2009 · DOI: 10.3390/ijms10062476 Molecular and genetic characterization of the gene family encoding the voltage-dependent anion channel in Arabidopsis.2011 · DOI: 10.1093/jxb/err113
`At5g57490`	Forms a channel through the mitochondrial outer membrane that allows diffusion of small hydrophilic molecules.	Molecular and genetic characterization of the gene family encoding the voltage-dependent anion channel in Arabidopsis.2011 · DOI: 10.1093/jxb/err113

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0202200`	Forms a channel through the mitochondrial outer membrane that allows diffusion of small hydrophilic molecules.	No verified direct reference in this release
`Os09g0361400`	Forms a channel through the mitochondrial outer membrane that allows diffusion of small hydrophilic molecules.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006703 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009527 plastid outer membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0046930 pore complex Cellular Component

GO:0008308 voltage-gated monoatomic anion channel activity Molecular Function

GO:0015288 porin activity Molecular Function

KEGG gene cross-reference

ath:AT5G57490

ath:AT5G67500

dosa:Os03g0202200

dosa:Os09g0361400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.928

Rank 1 · LXL04_006703 · OH-1004

Cytoplasm0.084

Rank 2 · LXL04_006703 · OH-1004

Cell membrane0.057

Rank 3 · LXL04_006703 · OH-1004

Nucleus0.051

Rank 4 · LXL04_006703 · OH-1004

Plastid0.023

Rank 5 · LXL04_006703 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01459.29Porin_34-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006703	`PF01459.29`	Porin_3	4	269	9.2e-71	239.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJX3`	Arabidopsis thaliana	Mitochondrial outer membrane protein porin 2	65.217%	Swiss-Prot	strong database homology
`Q9FKM2`	Arabidopsis thaliana	Mitochondrial outer membrane protein porin 4	46.377%	Swiss-Prot	moderate database homology
`Q84P97`	Oryza sativa subsp. japonica	Mitochondrial outer membrane protein porin 5	60.440%	Swiss-Prot	strong database homology
`Q6K548`	Oryza sativa subsp. japonica	Mitochondrial outer membrane protein porin 1	46.886%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card