Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1611 bp · LXL04_006595|LXL04_006595|OH1004|cDNA
ATGGCGCGATCTTCAATCTTGACCTCTCCATATTTACCTTTCAGCCTTTCTTCAATCACTCATCTCAATCAGAACAGTCGAGAAGGAACAAATCCGAACAGAAGGGCGACTTCAAATCGCGAATCCTCTGTTCAATCTTTCAGCCCGTCAATCTTTCAGCCCTCCAATCCCGAACTGAGTATAGAAACTTGCTTCTTACCACCAGTAACCTGTGCAATTGTATTGAACCAGGTCGAGTATGCTCGGTTCATGCTTTATCG...
1611 bp · LXL04_006595|LXL04_006595|OH1004|CDS
ATGGCGCGATCTTCAATCTTGACCTCTCCATATTTACCTTTCAGCCTTTCTTCAATCACTCATCTCAATCAGAACAGTCGAGAAGGAACAAATCCGAACAGAAGGGCGACTTCAAATCGCGAATCCTCTGTTCAATCTTTCAGCCCGTCAATCTTTCAGCCCTCCAATCCCGAACTGAGTATAGAAACTTGCTTCTTACCACCAGTAACCTGTGCAATTGTATTGAACCAGGTCGAGTATGCTCGGTTCATGCTTTATCG...
Protein
Download Protein FASTA536 aa · LXL04_006595|LXL04_006595|OH1004|PROTEIN
MARSSILTSPYLPFSLSSITHLNQNSREGTNPNRRATSNRESSVQSFSPSIFQPSNPELSIETCFLPPVTCAIVLNQVEYARFMLYRFESNEIDSPYLSSCYRFIFKAVEKSETKSPRFISNIPSFGIAFDIDGVILRGRCLKIPYLFLTNGGGIPESRRASELSQLLGVNIDPIQVVQGHSPFKNLLKRYFWNSERAAWESCYCRCSARGVSFFGGGGKGNFYSDIVNDQITLLQLLGTKTHNIPDDSGIPIEPSDESE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006595 |
|---|---|
| TK1151 ID | TkAUNG067190 |
| OH-1004 ID | LXL04_006595 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 75.500 |
| Protein coverage (%) | TK1151 51.606 / OH-1004 36.567Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006595 |
|---|---|
| Location | Chr02:17983739-17988587 (+) |
| Description | Similar to YKR070W: Uncharacterized protein YKR070W (Saccharomyces cerevisiae (strain ATCC 204508 / S288c) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0007006 mitochondrial membrane organization Biological Process GO:0031119 tRNA pseudouridine synthesis Biological Process GO:0032049 cardiolipin biosynthetic process Biological Process GO:0046474 glycerophospholipid biosynthetic process Biological Process GO:0055091 phospholipid homeostasis Biological Process GO:0005739 mitochondrion Cellular Component GO:0005743 mitochondrial inner membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0008808 cardiolipin synthase activity Molecular Function GO:0016787 hydrolase activity Molecular Function GO:0043337 cardiolipin synthase (CMP-forming) activity Molecular Function GO:0160147 tRNA pseudouridine(38-40) synthase activity Molecular Function |
| KEGG gene cross-reference | bav:BAV2265 hsa:27440 mmu:214932 sce:YKR070W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13344.13Hydrolase_6143-191 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_006595 | PF13344.13 | Hydrolase_6 | 143 | 191 | 2.5e-08 | 34.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.