Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1371 bp · LXL04_006370|LXL04_006370|OH1004|cDNA
ATGGCCGACGAAGCTCCGACTTCACAAGATCTTGCACCGAACGGCAATCAAACACCCGCGTCTGTTAATGCCACCATCGACTCTACAGGTCAGGGTGGCACCGGCACCACAGCCTCTTCGTGCAACAACAATAATGTCGCCGAAGCATCGGGACTGACTTTCGATGGAGACCGGGAGAAATCACTCGAGTATGCTGAAGAATTGATGGACAAAGGATCCAAGGCTAACAAAGAAGAAGACTTCGCCGAAGCCACTGATTG...
1371 bp · LXL04_006370|LXL04_006370|OH1004|CDS
ATGGCCGACGAAGCTCCGACTTCACAAGATCTTGCACCGAACGGCAATCAAACACCCGCGTCTGTTAATGCCACCATCGACTCTACAGGTCAGGGTGGCACCGGCACCACAGCCTCTTCGTGCAACAACAATAATGTCGCCGAAGCATCGGGACTGACTTTCGATGGAGACCGGGAGAAATCACTCGAGTATGCTGAAGAATTGATGGACAAAGGATCCAAGGCTAACAAAGAAGAAGACTTCGCCGAAGCCACTGATTG...
Protein
Download Protein FASTA456 aa · LXL04_006370|LXL04_006370|OH1004|PROTEIN
MADEAPTSQDLAPNGNQTPASVNATIDSTGQGGTGTTASSCNNNNVAEASGLTFDGDREKSLEYAEELMDKGSKANKEEDFAEATDCFSRALEIRAAHYGELAPECVRSYYKYGCALLYKAQEESDPLVSGTVSKKEATSDHTEIGSSKAAESGETSASSNTKETTSNIQQVTEDQDEDNEESDGDDEEDESDLDLAWKMLDVARAISEKQPGDTMEKVDILSALAEVALEREDVETSLSDYLKALSMLERLAEPDSRHI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006370 |
|---|---|
| TK1151 ID | TkA03G031000 |
| OH-1004 ID | LXL04_006370 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 85.300 |
| Protein coverage (%) | TK1151 95.565 / OH-1004 51.535Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006370 |
|---|---|
| Location | Chr02:8991320-8993225 (+) |
| Description | Similar to sim3: NASP-related protein sim3 (Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006260 DNA replication Biological Process GO:0006334 nucleosome assembly Biological Process GO:0006335 DNA replication-dependent chromatin assembly Biological Process GO:0015031 protein transport Biological Process GO:0033574 response to testosterone Biological Process GO:0034080 CENP-A containing chromatin assembly Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0032991 protein-containing complex Cellular Component GO:0042393 histone binding Molecular Function |
| KEGG gene cross-reference | bta:512427 hsa:4678 spo:2540895 xla:397901 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.