LXL04_006327 | RubberDandelionOmics

Gene overview

LXL04_006327

Reference: OH-1004 Chr: Chr02 Coordinates: 6996201-6997046 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

846 bp · LXL04_006327|LXL04_006327|OH1004|cDNA

ATGGGTAGGAAGAGAAAGCTAGCTAGCGATGAAGAAGGGACCATGAGTTTCGGTGGGCCCCCAAAAACCCGTAAAAAGTTTGTTGGTGTTAGGCAAAGACCATCCGGTAGATGGGTCGCAGAAATCAAAGACACCATACAGAAAATCAGAGTATGGTTAGGGACCTTTGACACTGCTGAAGAAGCGGCTCGGGCCTACGATGAAGCCGCGTGTTTGCTACGAGGAGCCAACACCCGCACCAACTTTTGGCCTTCTTCTCA...

CDS

Download CDS FASTA

846 bp · LXL04_006327|LXL04_006327|OH1004|CDS

ATGGGTAGGAAGAGAAAGCTAGCTAGCGATGAAGAAGGGACCATGAGTTTCGGTGGGCCCCCAAAAACCCGTAAAAAGTTTGTTGGTGTTAGGCAAAGACCATCCGGTAGATGGGTCGCAGAAATCAAAGACACCATACAGAAAATCAGAGTATGGTTAGGGACCTTTGACACTGCTGAAGAAGCGGCTCGGGCCTACGATGAAGCCGCGTGTTTGCTACGAGGAGCCAACACCCGCACCAACTTTTGGCCTTCTTCTCA...

Protein

Download Protein FASTA

281 aa · LXL04_006327|LXL04_006327|OH1004|PROTEIN

MGRKRKLASDEEGTMSFGGPPKTRKKFVGVRQRPSGRWVAEIKDTIQKIRVWLGTFDTAEEAARAYDEAACLLRGANTRTNFWPSSHMFSTKPALPSKITNMLLRRLEASNNSPPPPTLVTCHADVVESSDSYFTDFLNDLDAYFPVNNTMTSDVYYNNMIMSFESCTSVDVECNGGGEREDAKKEEEEEEEEEEEGIDFRFIDEVGSVHGFSPFDIAQEIAMEEEEEEPMTISEAVIRMKYERKFSASLYAFHGIPECL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006327`
TK1151 ID	TkA03G026810
OH-1004 ID	LXL04_006327
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.700
Protein coverage (%)	TK1151 90.863 / OH-1004 64.057 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006327

Location Chr02:6996201-6997046 (+)

Description Similar to ERN1: Ethylene-responsive transcription factor ERN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19790`	Probably acts as a transcriptional activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006327 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009877 nodulation Biological Process

GO:0035865 cellular response to potassium ion Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048528 post-embryonic root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT5G19790

mtr:11408318

mtr:11417172

mtr:11437275

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.963

Rank 1 · LXL04_006327 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_006327 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_006327 · OH-1004

Endoplasmic reticulum0.019

Rank 4 · LXL04_006327 · OH-1004

Plastid0.016

Rank 5 · LXL04_006327 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP226-75 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006327	`PF00847.27`	AP2	26	75	8e-16	58.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6J9S1`	Arabidopsis thaliana	Ethylene-responsive transcription factor RAP2-11	72.500%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card