LXL04_006118 | RubberDandelionOmics

Gene overview

LXL04_006118

Reference: OH-1004 Chr: Chr02 Coordinates: 1977856-1984965 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1788 bp · LXL04_006118|LXL04_006118|OH1004|cDNA

ATGCTTATTCTAAAACACCGCCTCACCGCCATGTCCACCGCTGCCGCCGCCATGTTGTCGTCTTCCTCTGTATCCCTCAGAAACCCTAGATTACCAATATCATCAAATTTCAATTACTCCGGTAGTGTAAAGTCCTGCAACCGCCTTCCTCTTTGCACTCACTTATCCAAAATGTCACTTCGCTGTTTCGCTTCGGCTACTACCACCGCTGTGGATAAAATCCCCGTGCTCAATCCCGTTGTTGAGATGGACGGTGATGA...

CDS

Download CDS FASTA

1788 bp · LXL04_006118|LXL04_006118|OH1004|CDS

ATGCTTATTCTAAAACACCGCCTCACCGCCATGTCCACCGCTGCCGCCGCCATGTTGTCGTCTTCCTCTGTATCCCTCAGAAACCCTAGATTACCAATATCATCAAATTTCAATTACTCCGGTAGTGTAAAGTCCTGCAACCGCCTTCCTCTTTGCACTCACTTATCCAAAATGTCACTTCGCTGTTTCGCTTCGGCTACTACCACCGCTGTGGATAAAATCCCCGTGCTCAATCCCGTTGTTGAGATGGACGGTGATGA...

Protein

Download Protein FASTA

595 aa · LXL04_006118|LXL04_006118|OH1004|PROTEIN

MLILKHRLTAMSTAAAAMLSSSSVSLRNPRLPISSNFNYSGSVKSCNRLPLCTHLSKMSLRCFASATTTAVDKIPVLNPVVEMDGDEMTRIIWQMIKDKLIFPYIDLDIKYFDLGILNRDATDDKVTVESAHAALKYNVAVKCATITPDETRVKEFGLKSMWRSPNGTIRNILDGTVFREPIMCKNVPRIVQGWKKPICIGRHAFGDQYRATDTIINGPGKLKIVFVPENAETTIELDVFDFKGPGIALAMYNVDESIRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006118`
TK1151 ID	TkA03G010380
OH-1004 ID	LXL04_006118
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006118

Location Chr02:1977856-1984965 (+)

Description Similar to At5g14590: Isocitrate dehydrogenase [NADP], chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14590`	May be involved in response to oxidative stresses.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006118 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006102 isocitrate metabolic process Biological Process

GO:0006739 NADP+ metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004450 isocitrate dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference

ath:AT5G14590

nta:107815853

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.574

Rank 1 · LXL04_006118 · OH-1004

Mitochondrion0.337

Rank 2 · LXL04_006118 · OH-1004

Cytoplasm0.106

Rank 3 · LXL04_006118 · OH-1004

Peroxisome0.070

Rank 4 · LXL04_006118 · OH-1004

Nucleus0.033

Rank 5 · LXL04_006118 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00180.26Iso_dh78-469 aa

PF00462.31Glutaredoxin503-565 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006118	`PF00180.26`	Iso_dh	78	469	3.2e-74	251.0
LXL04_006118	`PF00462.31`	Glutaredoxin	503	565	8.7e-21	74.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPJ5`	Arabidopsis thaliana	Isocitrate dehydrogenase [NADP], chloroplastic/mitochondrial	81.498%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card