Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3147 bp · LXL04_006023|LXL04_006023|OH1004|cDNA
ATGCCGCGCCGGCGAGACGAGTATGAAGAAGACGTGGACGAGGATCAGGATGACGCGATTGACGACGACGACGATGAGGATTATGGCAGTAGCCGTGGAGGCGGTGGAGGAAGCGACCGTAAGAGGAGGAGATCTGATTTTATTGATGATGTTGCcgaggaagatgaagatgaagaggaGGAGTACGACGAATATGATGAAGATtatggtggcggcggtggtgcgcGTCGTCGAGGAGGGAAAGCATCAAAAAAAGCATC...
3147 bp · LXL04_006023|LXL04_006023|OH1004|CDS
ATGCCGCGCCGGCGAGACGAGTATGAAGAAGACGTGGACGAGGATCAGGATGACGCGATTGACGACGACGACGATGAGGATTATGGCAGTAGCCGTGGAGGCGGTGGAGGAAGCGACCGTAAGAGGAGGAGATCTGATTTTATTGATGATGTTGCCGAGGAAGATGAAGATGAAGAGGAGGAGTACGACGAATATGATGAAGATTATGGTGGCGGCGGTGGTGCGCGTCGTCGAGGAGGGAAAGCATCAAAAAAAGCATC...
Protein
Download Protein FASTA1048 aa · LXL04_006023|LXL04_006023|OH1004|PROTEIN
MPRRRDEYEEDVDEDQDDAIDDDDDEDYGSSRGGGGGSDRKRRRSDFIDDVAEEDEDEEEEYDEYDEDYGGGGGARRRGGKASKKASGAGFFELEADVDTDAEEDEEEDGEDDFIVNERVDPHEEEDARRMHHRPLLSREDEQEDVEALERIIQERFARNRTEYDDDDATEVEQQALLPSVRDPKLWMVKCAIGHEREVAVCLMQKCIDRSSELQIRSAIALDHLKNYIYIEADKEAHVKEACKGMRNIYTGSKILLVPI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006023 |
|---|---|
| TK1151 ID | TkA03G001870 |
| OH-1004 ID | LXL04_006023 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.900 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006023 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:511838-518474 (+) | |||||||||
| Description | Similar to At4g08350: Putative transcription elongation factor SPT5 homolog 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006368 transcription elongation by RNA polymerase II Biological Process GO:0006412 translation Biological Process GO:0016239 positive regulation of macroautophagy Biological Process GO:0032784 regulation of DNA-templated transcription elongation Biological Process GO:0032785 negative regulation of DNA-templated transcription, elongation Biological Process GO:0032786 positive regulation of DNA-templated transcription, elongation Biological Process GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process GO:0034243 regulation of transcription elongation by RNA polymerase II Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0160239 transcription pausing by RNA polymerase II Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G34210 ath:AT4G08350 gga:426493 hsa:6829 mmu:20924 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF11942.14Spt5_N91-179 aaPF03439.19Spt5-NGN185-267 aaPF23042.3KOW1_SPT5276-402 aaPF23284.3KOW2_Spt5430-479 aaPF23037.2KOWx_SPT5538-589 aaPF23291.2KOW4_SPT5596-650 aaPF00467.36KOW606-629 aaPF23290.2KOW5_SPT5710-753 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_006023 | PF11942.14 | Spt5_N | 91 | 179 | 6.5e-12 | 47.0 |
| LXL04_006023 | PF03439.19 | Spt5-NGN | 185 | 267 | 4.9e-27 | 94.4 |
| LXL04_006023 | PF23042.3 | KOW1_SPT5 | 276 | 402 | 2.3e-33 | 116.2 |
| LXL04_006023 | PF23284.3 | KOW2_Spt5 | 430 | 479 | 6.6e-25 | 87.4 |
| LXL04_006023 | PF23037.2 | KOWx_SPT5 | 538 | 589 | 9.2e-18 | 64.3 |
| LXL04_006023 | PF23291.2 | KOW4_SPT5 | 596 | 650 | 3.4e-27 | 94.8 |
| LXL04_006023 | PF00467.36 | KOW | 606 | 629 | 8e-21 | 73.7 |
| LXL04_006023 | PF23290.2 | KOW5_SPT5 | 710 | 753 | 2e-16 | 59.9 |
| LXL04_006023 | PF23038.2 | KOW6_SPT51-2 | 940 | 990 | 3.3e-26 | 91.3 |
| LXL04_006023 | PF23287.2 | KOW7_SPT5 | 992 | 1043 | 7.3e-24 | 84.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.