LXL04_005837 | RubberDandelionOmics

Gene overview

LXL04_005837

Reference: OH-1004 Chr: Chr01 Coordinates: 174299195-174300506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

810 bp · LXL04_005837|LXL04_005837|OH1004|cDNA

ATGTCTACCCTTCATCCTTTATCGGGATTATGTATCTTCATTACCATCACGATGATCTTCACTAGTTTGGGATCCGTAAGTGCAGCCGGATATAAAACTGCACGTGCACCAGCTGTTTATAAGCCAAGCCCATGGACTCAAGCCCACGCCACGTTTTATGGGGACGAGTCTGCAGCTTCAACCTCGGGTGGTGCTTGTGGATATGGAAACGTTGTGACTAATGGGTACGGAACTGATACGGCCGCATTGAGCTCGACAAT...

CDS

Download CDS FASTA

810 bp · LXL04_005837|LXL04_005837|OH1004|CDS

ATGTCTACCCTTCATCCTTTATCGGGATTATGTATCTTCATTACCATCACGATGATCTTCACTAGTTTGGGATCCGTAAGTGCAGCCGGATATAAAACTGCACGTGCACCAGCTGTTTATAAGCCAAGCCCATGGACTCAAGCCCACGCCACGTTTTATGGGGACGAGTCTGCAGCTTCAACCTCGGGTGGTGCTTGTGGATATGGAAACGTTGTGACTAATGGGTACGGAACTGATACGGCCGCATTGAGCTCGACAAT...

Protein

Download Protein FASTA

269 aa · LXL04_005837|LXL04_005837|OH1004|PROTEIN

MSTLHPLSGLCIFITITMIFTSLGSVSAAGYKTARAPAVYKPSPWTQAHATFYGDESAASTSGGACGYGNVVTNGYGTDTAALSSTIFTDGYGCGQCYQIKCVQSPWCSTGVATITATNLCPPNYSKDSNNGGWCNPPRTHFDMAKPAFMQIAQWKAGIVPVMYRRVPCIRTGGIRFSFQGNGYWLLVYVMNVGGAGDISQMWVKGTKTAWINMSHNWGASYQAFATLKGQALSFKITSYTTKQTIVCNNVAPANWNLGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005837`
TK1151 ID	TkA01G013670
OH-1004 ID	LXL04_005837
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 93.680 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005837

Location Chr01:174299195-174300506 (-)

Description Similar to EXPA7: Expansin-A7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12560`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At1g62980`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At2g39700`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At5g02260`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0535900`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005837 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006949 syncytium formation Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0048767 root hair elongation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G12560

ath:AT1G62980

ath:AT2G39700

ath:AT5G02260

osa:107277540

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.639

Rank 1 · LXL04_005837 · OH-1004

Cytoplasm0.121

Rank 2 · LXL04_005837 · OH-1004

Lysosome / Vacuole0.098

Rank 3 · LXL04_005837 · OH-1004

Endoplasmic reticulum0.098

Rank 4 · LXL04_005837 · OH-1004

Cell membrane0.061

Rank 5 · LXL04_005837 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29515.1Expansin_N58-124 aa

PF03330.25DPBB_180-164 aa

PF01357.28Expansin_C175-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005837	`PF29515.1`	Expansin_N	58	124	3.2e-09	37.7
LXL04_005837	`PF03330.25`	DPBB_1	80	164	8.9e-20	71.4
LXL04_005837	`PF01357.28`	Expansin_C	175	253	1.5e-26	93.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LN94`	Arabidopsis thaliana	Expansin-A7	63.566%	Swiss-Prot	strong database homology
`Q9LQ07`	Arabidopsis thaliana	Expansin-A18	60.687%	Swiss-Prot	strong database homology
`O48818`	Arabidopsis thaliana	Expansin-A4	50.781%	Swiss-Prot	strong database homology
`Q9LZ99`	Arabidopsis thaliana	Expansin-A9	52.542%	Swiss-Prot	strong database homology
`Q8W2X8`	Oryza sativa subsp. japonica	Putative expansin-A30	64.919%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card