LXL04_005675 | RubberDandelionOmics

Gene overview

LXL04_005675

Reference: OH-1004 Chr: Chr01 Coordinates: 170776523-170777938 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · LXL04_005675|LXL04_005675|OH1004|cDNA

ATGGTGGTAGTGCAAGTGAGGGGTTTATCATCCGCCAAACGGCTTTACCAGACGATCTGGTATCAATGCTCACGAACAATTACATCCAACAGATTGATTCAGGAGCCAATTTCTCGAATCCAAACAACACTTGACTCAGAAATGGTGGGAAAATCAGGCATCGAAAACCTCGACCTTTCATGGGATTCGCTCCTGACTTCTATTCGTTCTTCCGCCCCTCACAAAGCTCAGCTCGTTCTTGAACGGGGGTTACAGAAATT...

CDS

Download CDS FASTA

1254 bp · LXL04_005675|LXL04_005675|OH1004|CDS

ATGGTGGTAGTGCAAGTGAGGGGTTTATCATCCGCCAAACGGCTTTACCAGACGATCTGGTATCAATGCTCACGAACAATTACATCCAACAGATTGATTCAGGAGCCAATTTCTCGAATCCAAACAACACTTGACTCAGAAATGGTGGGAAAATCAGGCATCGAAAACCTCGACCTTTCATGGGATTCGCTCCTGACTTCTATTCGTTCTTCCGCCCCTCACAAAGCTCAGCTCGTTCTTGAACGGGGGTTACAGAAATT...

Protein

Download Protein FASTA

417 aa · LXL04_005675|LXL04_005675|OH1004|PROTEIN

MVVVQVRGLSSAKRLYQTIWYQCSRTITSNRLIQEPISRIQTTLDSEMVGKSGIENLDLSWDSLLTSIRSSAPHKAQLVLERGLQKLQKENEKNHDIYLELIHICAKIQNPKTAMRVFTLMENQGLKPTTTILNALISAHISSGNTITSLSIFQTMQNSDDYKPTSHTYNLFISSFANYGNSKAMLAWYESKMNLGFSADLDTYEAIILGCIKLKRYEEANRFYKEMLSSPQIKPNTSILNNMLMGLCEQNDLDKIRDFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005675`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005675

Location Chr01:170776523-170777938 (-)

Description Similar to At4g26680: Pentatricopeptide repeat-containing protein At4g26680, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26680`	Pentatricopeptide repeat-containing protein At4g26680, mitochondrial.	No verified direct reference in this release
`At5g38730`	Pentatricopeptide repeat-containing protein At5g38730.	No verified direct reference in this release
`At2g30780`	Pentatricopeptide repeat-containing protein At2g30780.	No verified direct reference in this release
`At5g48730`	Pentatricopeptide repeat-containing protein At5g48730, chloroplastic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0750400`	Involved in the biogenesis of the plastid translation machinery by promoting the splicing of group II introns in chloroplasts.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005675 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003727 single-stranded RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G30780

ath:AT4G26680

ath:AT5G38730

ath:AT5G48730

dosa:Os02g0750400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.834

Rank 1 · LXL04_005675 · OH-1004

Plastid0.090

Rank 2 · LXL04_005675 · OH-1004

Nucleus0.052

Rank 3 · LXL04_005675 · OH-1004

Cytoplasm0.043

Rank 4 · LXL04_005675 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_005675 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N54-185 aa

PF13812.13PPR_398-139 aa

PF23276.3TPR_2498-227 aa

PF13041.13PPR_2128-178 aa

PF29070.1MSC6_N200-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005675	`PF29070.1`	MSC6_N	54	185	1.2e-18	68.1
LXL04_005675	`PF13812.13`	PPR_3	98	139	1.4e-15	57.9
LXL04_005675	`PF23276.3`	TPR_24	98	227	1.2e-07	32.4
LXL04_005675	`PF13041.13`	PPR_2	128	178	1.5e-19	70.6
LXL04_005675	`PF29070.1`	MSC6_N	200	296	1.2e-18	68.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZ10`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g26680, mitochondrial	25.854%	Swiss-Prot	weak database homology
`Q9FKR3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g38730	25.591%	Swiss-Prot	weak database homology
`O49343`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g30780	21.975%	Swiss-Prot	weak database homology
`Q9FKC3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g48730, chloroplastic	23.588%	Swiss-Prot	weak database homology
`A3ABE1`	Oryza sativa subsp. japonica	Pentatricopeptide repeat-containing protein PPR5 homolog, chloroplastic	23.304%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card