LXL04_005652 | RubberDandelionOmics

Gene overview

LXL04_005652

Reference: OH-1004 Chr: Chr01 Coordinates: 170098764-170101778 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1593 bp · LXL04_005652|LXL04_005652|OH1004|cDNA

ATGATGAAGCTGCAGACGTATGCTGGACTCAGTATAGTTGCCACACTGGTTGTTATCTATCATGCATTTAGTAGCCGAGGCCAATTTTACCCAGCAACAGTCTATCTATCTACATCCAAAGTCTGTCTAGTCCTTCTTCTCAACATGGGTTTGGTGATCATGTGCATTATGTGGCAgctaacaaaaaaaatatttcttgGTTCTCTTCGAGAAGCAGAAATTGAGAGACTGAATGAGCAATCATGGCGGGAAGTTATGGA...

CDS

Download CDS FASTA

1593 bp · LXL04_005652|LXL04_005652|OH1004|CDS

ATGATGAAGCTGCAGACGTATGCTGGACTCAGTATAGTTGCCACACTGGTTGTTATCTATCATGCATTTAGTAGCCGAGGCCAATTTTACCCAGCAACAGTCTATCTATCTACATCCAAAGTCTGTCTAGTCCTTCTTCTCAACATGGGTTTGGTGATCATGTGCATTATGTGGCAGCTAACAAAAAAAATATTTCTTGGTTCTCTTCGAGAAGCAGAAATTGAGAGACTGAATGAGCAATCATGGCGGGAAGTTATGGA...

Protein

Download Protein FASTA

530 aa · LXL04_005652|LXL04_005652|OH1004|PROTEIN

MMKLQTYAGLSIVATLVVIYHAFSSRGQFYPATVYLSTSKVCLVLLLNMGLVIMCIMWQLTKKIFLGSLREAEIERLNEQSWREVMEILFAITIFRQDFSVMFLAMVTALLLIKSLHWLAQKRVEYIETTPTVPMLSHIRIVSFMGFLLLVDSLFLYNSVKYLIKTRQASVSLFFSFEYTILATTTISTFVKYVFYVTDMLMEGQWEKKAVYTFYLELIRDLLHLSLYLGFFLVIFVNYGVPLHLIRELYETFRNFKLRI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005652`
TK1151 ID	TkA01G027660
OH-1004 ID	LXL04_005652
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005652

Location Chr01:170098764-170101778 (-)

Description Similar to HRD1A: ERAD-associated E3 ubiquitin-protein ligase HRD1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16090`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release
`At1g65040`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0301000`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005652 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0050821 protein stabilization Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

GO:1904276 regulation of wax biosynthetic process Biological Process

GO:1904380 endoplasmic reticulum mannose trimming Biological Process

GO:0000836 Hrd1p ubiquitin ligase complex Cellular Component

GO:0000839 Hrd1p ubiquitin ligase ERAD-L complex Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G65040

ath:AT3G16090

dosa:Os06g0301000

hsa:84447

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.542

Rank 1 · LXL04_005652 · OH-1004

Golgi apparatus0.235

Rank 2 · LXL04_005652 · OH-1004

Nucleus0.139

Rank 3 · LXL04_005652 · OH-1004

Cytoplasm0.124

Rank 4 · LXL04_005652 · OH-1004

Cell membrane0.103

Rank 5 · LXL04_005652 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25563.1TPR_SYVN1_N3-272 aa

PF12678.14zf-rbx1289-330 aa

PF13639.13zf-RING_2291-330 aa

PF00097.32zf-C3HC4292-329 aa

PF13445.13zf-RING_UBOX292-327 aa

PF13923.13zf-C3HC4_2292-329 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005652	`PF25563.1`	TPR_SYVN1_N	3	272	2.5e-107	359.1
LXL04_005652	`PF12678.14`	zf-rbx1	289	330	1.2e-08	35.8
LXL04_005652	`PF13639.13`	zf-RING_2	291	330	2.9e-11	44.1
LXL04_005652	`PF00097.32`	zf-C3HC4	292	329	2.3e-07	31.3
LXL04_005652	`PF13445.13`	zf-RING_UBOX	292	327	1e-06	29.3
LXL04_005652	`PF13923.13`	zf-C3HC4_2	292	329	4e-06	27.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LW77`	Arabidopsis thaliana	ERAD-associated E3 ubiquitin-protein ligase HRD1A	63.928%	Swiss-Prot	strong database homology
`Q6NPT7`	Arabidopsis thaliana	ERAD-associated E3 ubiquitin-protein ligase HRD1B	64.990%	Swiss-Prot	strong database homology
`Q5Z880`	Oryza sativa subsp. japonica	ERAD-associated E3 ubiquitin-protein ligase HRD1	61.328%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card