LXL04_005554 | RubberDandelionOmics

Gene overview

LXL04_005554

Reference: OH-1004 Chr: Chr01 Coordinates: 168346593-168352633 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2643 bp · LXL04_005554|LXL04_005554|OH1004|cDNA

ATGAGCGGCCACGATTCAAAGTACTTCTCCACAACTAAGAAAGGAGAAATCCCTGAGCTCAAAGAGGAGCTCAATTCTCAGTATAAGGATAAGAGAAAAGATGCTGTTAAGAAGACAATTGCAGCCATGACAGTTGGCAAGGACGTATCATCACTTTTCACAGATGTTTTAAACTGTATGCAGACCGAGAACTTGGAGCTCAAAAAGCTTGTTTACTTATATCTCATCAATTATGCCAAAAGTCAACCTGACCTCGCAAT...

CDS

Download CDS FASTA

2643 bp · LXL04_005554|LXL04_005554|OH1004|CDS

ATGAGCGGCCACGATTCAAAGTACTTCTCCACAACTAAGAAAGGAGAAATCCCTGAGCTCAAAGAGGAGCTCAATTCTCAGTATAAGGATAAGAGAAAAGATGCTGTTAAGAAGACAATTGCAGCCATGACAGTTGGCAAGGACGTATCATCACTTTTCACAGATGTTTTAAACTGTATGCAGACCGAGAACTTGGAGCTCAAAAAGCTTGTTTACTTATATCTCATCAATTATGCCAAAAGTCAACCTGACCTCGCAAT...

Protein

Download Protein FASTA

880 aa · LXL04_005554|LXL04_005554|OH1004|PROTEIN

MSGHDSKYFSTTKKGEIPELKEELNSQYKDKRKDAVKKTIAAMTVGKDVSSLFTDVLNCMQTENLELKKLVYLYLINYAKSQPDLAILAVNTFVKDTQDPNPLIRALAVRTMGCIRVDKITEYLCDPLQRCLKDDDPYVRKTAAICVAKLYDINAELVEDRRFLDGLKDLISDNNPMVVANAIAALAEIQDNSSTPVFEITTSTLSKLLTALNECTEWGQVFILDALSKYKSADAREAENIVERITPRLQHANCAVVLSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005554`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005554

Location Chr01:168346593-168352633 (+)

Description Similar to BETAC-AD: Beta-adaptin-like protein C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23460`	Subunit of clathrin-associated adaptor protein complex that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes.	No verified direct reference in this release
`At4g11380`	Subunit of clathrin-associated adaptor protein complex that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005554 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0007368 determination of left/right symmetry Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0048268 clathrin coat assembly Biological Process

GO:0060155 platelet dense granule organization Biological Process

GO:0110010 basolateral protein secretion Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT4G11380

ath:AT4G23460

hsa:162

mmu:11764

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.550

Rank 1 · LXL04_005554 · OH-1004

Golgi apparatus0.367

Rank 2 · LXL04_005554 · OH-1004

Nucleus0.163

Rank 3 · LXL04_005554 · OH-1004

Lysosome / Vacuole0.159

Rank 4 · LXL04_005554 · OH-1004

Cell membrane0.141

Rank 5 · LXL04_005554 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N14-534 aa

PF20168.5PDS517-192 aa

PF13646.13HEAT_298-152 aa

PF12717.14Cnd1103-266 aa

PF02883.27Alpha_adaptinC2661-758 aa

PF09066.16B2-adapt-app_C770-878 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005554	`PF01602.27`	Adaptin_N	14	534	2.8e-167	558.2
LXL04_005554	`PF20168.5`	PDS5	17	192	1.1e-06	27.6
LXL04_005554	`PF13646.13`	HEAT_2	98	152	1.4e-15	58.1
LXL04_005554	`PF12717.14`	Cnd1	103	266	1.2e-65	221.3
LXL04_005554	`PF02883.27`	Alpha_adaptinC2	661	758	8.1e-07	30.0
LXL04_005554	`PF09066.16`	B2-adapt-app_C	770	878	6.1e-31	107.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81742`	Arabidopsis thaliana	Beta-adaptin-like protein C	81.544%	Swiss-Prot	strong database homology
`Q9SUS3`	Arabidopsis thaliana	Beta-adaptin-like protein B	81.849%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card