LXL04_005530 | RubberDandelionOmics

Gene overview

LXL04_005530

Reference: OH-1004 Chr: Chr01 Coordinates: 167623182-167625870 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1662 bp · LXL04_005530|LXL04_005530|OH1004|cDNA

ATGAGGCGAACGAGATTAGGGAGAGGTAAAACTGAGAGAGGGAGAGGGTTGCATTGGGCTGAGGCCGGAACATTctactcgccggaaaactcccTGCCTGCCGGTTTTCAGTCGCCGGAACATGCTACTCGATTCACATACCTCCGATTTCGATTTTTCGGATTACTAGCCAATCCAGCGGGGAAGGGCAGTCCATTGTTTACAATCCGATTCCAAGACAAAGAGAGATCACGATTGTTAACAGCAAAGAGAGATCACGA...

CDS

Download CDS FASTA

1662 bp · LXL04_005530|LXL04_005530|OH1004|CDS

ATGAGGCGAACGAGATTAGGGAGAGGTAAAACTGAGAGAGGGAGAGGGTTGCATTGGGCTGAGGCCGGAACATTCTACTCGCCGGAAAACTCCCTGCCTGCCGGTTTTCAGTCGCCGGAACATGCTACTCGATTCACATACCTCCGATTTCGATTTTTCGGATTACTAGCCAATCCAGCGGGGAAGGGCAGTCCATTGTTTACAATCCGATTCCAAGACAAAGAGAGATCACGATTGTTAACAGCAAAGAGAGATCACGA...

Protein

Download Protein FASTA

553 aa · LXL04_005530|LXL04_005530|OH1004|PROTEIN

MRRTRLGRGKTERGRGLHWAEAGTFYSPENSLPAGFQSPEHATRFTYLRFRFFGLLANPAGKGSPLFTIRFQDKERSRLLTAKRDHDLLHRYADHFVPAFNAYMAFLLFLLHRYADHFTSFIIIFSQNKILLTNIHSQVLKTPVSMDMLGRIFNGSGKPIDNGPPILPEAYLDISGSSINPSERTYPEEMIQTGISTIDVMNSIARGQKIPLFSAAGLPHNEIAAQICRQAGLVKRLEKTENLLEAGGEEDNFAIVFAAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005530`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005530

Location Chr01:167623182-167625870 (+)

Description Similar to VHA-B3: V-type proton ATPase subunit B3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20260`	Non-catalytic subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release
`At4g38510`	Non-catalytic subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release
`At1g76030`	Non-catalytic subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005530 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0007035 vacuolar acidification Biological Process

GO:0010255 glucose mediated signaling pathway Biological Process

GO:0030835 negative regulation of actin filament depolymerization Biological Process

GO:0046034 ATP metabolic process Biological Process

GO:0051017 actin filament bundle assembly Biological Process

GO:0051693 actin filament capping Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000221 vacuolar proton-transporting V-type ATPase, V1 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G20260

ath:AT1G76030

ath:AT4G38510

ghi:107890851

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.303

Rank 1 · LXL04_005530 · OH-1004

Cytoplasm0.277

Rank 2 · LXL04_005530 · OH-1004

Nucleus0.133

Rank 3 · LXL04_005530 · OH-1004

Plastid0.120

Rank 4 · LXL04_005530 · OH-1004

Peroxisome0.111

Rank 5 · LXL04_005530 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00006.32ATP-synt_ab194-417 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005530	`PF00006.32`	ATP-synt_ab	194	417	7.1e-71	238.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4E2`	Arabidopsis thaliana	V-type proton ATPase subunit B3	90.492%	Swiss-Prot	moderate database homology
`Q9SZN1`	Arabidopsis thaliana	V-type proton ATPase subunit B2	90.492%	Swiss-Prot	moderate database homology
`P11574`	Arabidopsis thaliana	V-type proton ATPase subunit B1	90.820%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card