LXL04_005405 | RubberDandelionOmics

Gene overview

LXL04_005405

Reference: OH-1004 Chr: Chr01 Coordinates: 162690949-162696060 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2520 bp · LXL04_005405|LXL04_005405|OH1004|cDNA

AATACCCCCATCAAACGATCACTTCGAAGGTCATCGAAGGGCAAAATCGTCGTTTTAGTCTTCACCCACCTCAAAATCCCGCCAACACGTTTGTGGTGTGTGGGAAagatgaagctatcttcctcaAAACAACACTTTCCTCTGTTTTCTCCTTCTAATGGCACCTCTAAGTTACACTTCACTACCCTCATCAAACCCTCATTTACACATTCTCACCTCCATTTTCCCTATGCACATGCTCTCGAcgcttcttcttcctc...

CDS

Download CDS FASTA

2430 bp · LXL04_005405|LXL04_005405|OH1004|CDS

TTGTGGTGTGTGGGAAAGATGAAGCTATCTTCCTCAAAACAACACTTTCCTCTGTTTTCTCCTTCTAATGGCACCTCTAAGTTACACTTCACTACCCTCATCAAACCCTCATTTACACATTCTCACCTCCATTTTCCCTATGCACATGCTCTCGACGCTTCTTCTTCCTCCTCCGCGGCATCGACTCCGGCACCGGTGCTTGGCCAAGATGCAATTCCCGTCGAACTCGACGATACTGAAAGCGGTGAAGCGGCCAATCA...

Protein

Download Protein FASTA

809 aa · LXL04_005405|LXL04_005405|OH1004|PROTEIN

MWCVGKMKLSSSKQHFPLFSPSNGTSKLHFTTLIKPSFTHSHLHFPYAHALDASSSSSAASTPAPVLGQDAIPVELDDTESGEAANQTLDDLLVVRRPVMESTDDGEYGEDDDVESEIDQESSSFTSTSSVIDTNLSNFAMKMPIFEPKRVGSSSTSETPLVVNLDLALYKAKVLARNFRYKEAEEVLQKCISIWPEDGRCYVALGKILGKQSKSNEARAVYEKGCQATQGENAYIWQVSLAIHPYSRDYYCKPYISFPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005405`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005405

Location Chr01:162690949-162696060 (-)

Description Similar to HCF107: Protein high chlorophyll fluorescent 107

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17040`	Involved, directly or indirectly, in the processing of chloroplast encoded mRNAs.	The nucleus-encoded HCF107 gene of Arabidopsis provides a link between intercistronic RNA processing and the accumulation of translation-competent psbH transcripts in chloroplasts.2001 · DOI: 10.1105/tpc.010090 The nuclear gene HCF107 encodes a membrane-associated R-TPR (RNA tetratricopeptide repeat)-containing protein involved in expression of the plastidial psbH gene in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02409.x
`At4g03430`	Pre-mRNA splicing factor required for splicing and for the turnover of unstable transcripts.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005405 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0009657 plastid organization Biological Process

GO:0010114 response to red light Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000974 Prp19 complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G17040

spo:2541185

yli:2907810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.891

Rank 1 · LXL04_005405 · OH-1004

Nucleus0.076

Rank 2 · LXL04_005405 · OH-1004

Mitochondrion0.070

Rank 3 · LXL04_005405 · OH-1004

Cytoplasm0.043

Rank 4 · LXL04_005405 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_005405 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13424.13TPR_12170-227 aa

PF23241.2HAT_PRP39_C286-394 aa

PF29376.1PRP6_TPR332-466 aa

PF13428.13TPR_14363-402 aa

PF29376.1PRP6_TPR444-555 aa

PF23241.2HAT_PRP39_C447-544 aa

PF13424.13TPR_12473-529 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005405	`PF13424.13`	TPR_12	170	227	4.2e-19	69.2
LXL04_005405	`PF23241.2`	HAT_PRP39_C	286	394	3e-10	41.0
LXL04_005405	`PF29376.1`	PRP6_TPR	332	466	9.3e-22	78.0
LXL04_005405	`PF13428.13`	TPR_14	363	402	1.9e-28	96.7
LXL04_005405	`PF29376.1`	PRP6_TPR	444	555	9.3e-22	78.0
LXL04_005405	`PF23241.2`	HAT_PRP39_C	447	544	3e-10	41.0
LXL04_005405	`PF13424.13`	TPR_12	473	529	4.2e-19	69.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWG2`	Arabidopsis thaliana	Protein high chlorophyll fluorescent 107	67.912%	Swiss-Prot	strong database homology
`Q9ZT71`	Arabidopsis thaliana	Protein STABILIZED1	25.877%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card