LXL04_005388 | RubberDandelionOmics

Gene overview

LXL04_005388

Reference: OH-1004 Chr: Chr01 Coordinates: 162519382-162522968 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3126 bp · LXL04_005388|LXL04_005388|OH1004|cDNA

ATGAAAATGTTTCCTTTAGAGCAATTTGATATTTCTAAACTTCCGTACGACGATGCTTCTCCCGACAATCTTGATACTCTTTGTTTCAAATTCACCTCACCACCTCTTCAAAATACATTAAAATCTCCAGATTTCAAATTGGAAGACGATGAACAAAACAACCCTTTTGCATCACTTGGAATCGTTACAGACTTCCCAACCACATCATCAACATTTAATGGCGGCAAACAACTTCATGTTCCGATATGTAATAACGTTGA...

CDS

Download CDS FASTA

3126 bp · LXL04_005388|LXL04_005388|OH1004|CDS

ATGAAAATGTTTCCTTTAGAGCAATTTGATATTTCTAAACTTCCGTACGACGATGCTTCTCCCGACAATCTTGATACTCTTTGTTTCAAATTCACCTCACCACCTCTTCAAAATACATTAAAATCTCCAGATTTCAAATTGGAAGACGATGAACAAAACAACCCTTTTGCATCACTTGGAATCGTTACAGACTTCCCAACCACATCATCAACATTTAATGGCGGCAAACAACTTCATGTTCCGATATGTAATAACGTTGA...

Protein

Download Protein FASTA

1041 aa · LXL04_005388|LXL04_005388|OH1004|PROTEIN

MKMFPLEQFDISKLPYDDASPDNLDTLCFKFTSPPLQNTLKSPDFKLEDDEQNNPFASLGIVTDFPTTSSTFNGGKQLHVPICNNVEDSKTKRQNLSTPEKIRIAGQQFIDSYSLKADEVSELITHPFAVSFSGLSDDETKDIQLLLTLLSSAEKAGKKQFNRAKKLLQLCSDISLNEGNPVERLVYYFSEAIRMKINSEIGKVALNGLESMQFDLQEALMNVDTCIFAFHQKVPLSQVCQFSSFHTIIDNLYKSRKIHV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005388`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005388

Location Chr01:162519382-162522968 (-)

Description Similar to RGL2: DELLA protein RGL2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03450`	Probable transcriptional regulator that acts as a repressor of the gibberellin (GA) signaling pathway.	Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition.2002 · DOI: 10.1101/gad.969002 Gibberellin regulates Arabidopsis floral development via suppression of DELLA protein function.2004 · DOI: 10.1242/dev.00992 Floral homeotic genes are targets of gibberellin signaling in flower development.2004 · DOI: 10.1073/pnas.0402377101 Loss of function of four DELLA genes leads to light- and gibberellin-independent seed germination in Arabidopsis.2005 · DOI: 10.1007/s00425-005-0057-3 Phytohormone signalling pathways interact with sugars during seed germination and seedling development.2006 · DOI: 10.1093/jxb/erl096 Seed germination of GA-insensitive sleepy1 mutants does not require RGL2 protein disappearance in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048009 Genetic and molecular regulation by DELLA proteins of trichome development in Arabidopsis.2007 · DOI: 10.1104/pp.107.104794 High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds.2008 · DOI: 10.1104/pp.107.113738 The gibberellic acid signaling repressor RGL2 inhibits Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 activity.2008 · DOI: 10.1105/tpc.108.061515 Transcriptional diversification and functional conservation between DELLA proteins in Arabidopsis.2010 · DOI: 10.1093/molbev/msq012 A seed coat bedding assay shows that RGL2-dependent release of abscisic acid by the endosperm controls embryo growth in Arabidopsis dormant seeds.2010 · DOI: 10.1073/pnas.1012896107

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q2TN88`	Probable transcriptional regulator that acts as a repressor of the gibberellin (GA) signaling pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005388 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009938 negative regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

KEGG gene cross-reference

ath:AT3G03450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.665

Rank 1 · LXL04_005388 · OH-1004

Nucleus0.387

Rank 2 · LXL04_005388 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_005388 · OH-1004

Endoplasmic reticulum0.051

Rank 4 · LXL04_005388 · OH-1004

Plastid0.027

Rank 5 · LXL04_005388 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514.21GRAS148-503 aa

PF03514.21GRAS681-1039 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005388	`PF03514.21`	GRAS	148	503	2.1e-138	462.1
LXL04_005388	`PF03514.21`	GRAS	681	1039	2.1e-138	462.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXW1`	Arabidopsis thaliana	DELLA protein RGL2	29.412%	Swiss-Prot	weak database homology
`Q2TN88`	Oryza sativa subsp. indica	DELLA protein SLR1	26.866%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card