Gene Card
Gene overview
cDNA / CDS / Protein Sequences
519 bp · LXL04_005297|LXL04_005297|OH1004|cDNA
ATGAAGTTGACGACAAAAGTATCATTTTGGTCACCGGTGAAAATGCAGGAGCAGGCTGCGACGAGTTCAATGGCGGCGAGCTTGCCTTCAAGTAGCGAGAGATCTTCAAGCTCTGCTCCCcaagttgaaatcaaagaagGAATGGAGAGCGACGACGAAATCAGACGAGTACCGGATATGGGCGGAGAAGCCGCCGGAGCATCACGATCCGGCAGAGAAACCGGTTCAAATCCAAATTCAGACCGAGTTCAAGGATCAGC...
519 bp · LXL04_005297|LXL04_005297|OH1004|CDS
ATGAAGTTGACGACAAAAGTATCATTTTGGTCACCGGTGAAAATGCAGGAGCAGGCTGCGACGAGTTCAATGGCGGCGAGCTTGCCTTCAAGTAGCGAGAGATCTTCAAGCTCTGCTCCCCAAGTTGAAATCAAAGAAGGAATGGAGAGCGACGACGAAATCAGACGAGTACCGGATATGGGCGGAGAAGCCGCCGGAGCATCACGATCCGGCAGAGAAACCGGTTCAAATCCAAATTCAGACCGAGTTCAAGGATCAGC...
Protein
Download Protein FASTA172 aa · LXL04_005297|LXL04_005297|OH1004|PROTEIN
MKLTTKVSFWSPVKMQEQAATSSMAASLPSSSERSSSSAPQVEIKEGMESDDEIRRVPDMGGEAAGASRSGRETGSNPNSDRVQGSAEGTRKKAKTPADKENKRLKRLLRNRVSAQQARERKKAYMSELEARVKDLEKKNSELEERLSTMQNENQMLRHILKNTTSGMQERK
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_005297 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_005297 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:159852677-159854016 (+) | |||||||||
| Description | Similar to HY5: Transcription factor HY5 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0001558 regulation of cell growth Biological Process GO:0001934 positive regulation of protein phosphorylation Biological Process GO:0001935 endothelial cell proliferation Biological Process GO:0002639 positive regulation of immunoglobulin production Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006366 transcription by RNA polymerase II Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006629 lipid metabolic process Biological Process GO:0006914 autophagy Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G17609 ath:AT5G11260 mmu:22433 sly:543733 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00170.27bZIP_1100-160 aaPF07716.21bZIP_2100-153 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_005297 | PF00170.27 | bZIP_1 | 100 | 160 | 5.8e-15 | 55.9 |
| LXL04_005297 | PF07716.21 | bZIP_2 | 100 | 153 | 4.2e-10 | 40.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.