LXL04_005184 | RubberDandelionOmics

Gene overview

LXL04_005184

Reference: OH-1004 Chr: Chr01 Coordinates: 157434128-157435443 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

696 bp · LXL04_005184|LXL04_005184|OH1004|cDNA

ATGGCGGTTATTACTTTCTCTGATCTGCACACCGAGGCTGGCCTCCGATCCCTCGAATCCTTCCTCGCCGGGAAGTCATACATTTCCGGGAATCAAATGACAAAGGATGATGTGAAGGTTTACGCAGCTGTTTTGGAGAAACCTAGTGCAGATCTCTATCCCTCTGCAAGCAAGTGGTACGACTGCATTGCTACGAAACTTGCCACAAGTTTCCCTGGTAAAGCAGCAGGGGTTAGAATTTCAACCCATGCATCATCAGC...

CDS

Download CDS FASTA

696 bp · LXL04_005184|LXL04_005184|OH1004|CDS

ATGGCGGTTATTACTTTCTCTGATCTGCACACCGAGGCTGGCCTCCGATCCCTCGAATCCTTCCTCGCCGGGAAGTCATACATTTCCGGGAATCAAATGACAAAGGATGATGTGAAGGTTTACGCAGCTGTTTTGGAGAAACCTAGTGCAGATCTCTATCCCTCTGCAAGCAAGTGGTACGACTGCATTGCTACGAAACTTGCCACAAGTTTCCCTGGTAAAGCAGCAGGGGTTAGAATTTCAACCCATGCATCATCAGC...

Protein

Download Protein FASTA

231 aa · LXL04_005184|LXL04_005184|OH1004|PROTEIN

MAVITFSDLHTEAGLRSLESFLAGKSYISGNQMTKDDVKVYAAVLEKPSADLYPSASKWYDCIATKLATSFPGKAAGVRISTHASSAESVLVNGVNGMAKEASAADEDDDLDLFGDETEEEQKAAEAREQAKASTKKKESGKSSVLMDVKPWDDETDMKKLEEAVRSVHMEGLLWGASKLVPVGYGIKKLTIMMTIVDDLVSVDTLIEERLTVEPISDYVQSCDIVAFNKI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005184`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005184

Location Chr01:157434128-157435443 (+)

Description Similar to At5g12110: Elongation factor 1-beta 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12110`	EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release
`At5g19510`	EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0662500`	EF-1-beta and EF-1-beta' stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005184 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006414 translational elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005853 eukaryotic translation elongation factor 1 complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0048046 apoplast Cellular Component

GO:0003746 translation elongation factor activity Molecular Function

GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function

KEGG gene cross-reference

ath:AT5G12110

ath:AT5G19510

dosa:Os07g0662500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.815

Rank 1 · LXL04_005184 · OH-1004

Nucleus0.288

Rank 2 · LXL04_005184 · OH-1004

Endoplasmic reticulum0.074

Rank 3 · LXL04_005184 · OH-1004

Cell membrane0.058

Rank 4 · LXL04_005184 · OH-1004

Mitochondrion0.057

Rank 5 · LXL04_005184 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00736.25EF1_GNE144-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005184	`PF00736.25`	EF1_GNE	144	231	3.7e-32	111.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WM9`	Arabidopsis thaliana	Elongation factor 1-beta 1	67.249%	Swiss-Prot	strong database homology
`Q9SCX3`	Arabidopsis thaliana	Elongation factor 1-beta 2	69.432%	Swiss-Prot	strong database homology
`P29545`	Oryza sativa subsp. japonica	Elongation factor 1-beta	63.596%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card