LXL04_004961 | RubberDandelionOmics

Gene overview

LXL04_004961

Reference: OH-1004 Chr: Chr01 Coordinates: 151026604-151028918 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

966 bp · LXL04_004961|LXL04_004961|OH1004|cDNA

ATGGCAATTCACAAACTACTTTGCATCTTTCTTTTTTTCCTTCATTTTTATTCTGGTCATAGTGAACTACAATTGAATTACTACTCACAAAGTTGTCCTAACGCTGAAGAAATAGTCAAAGAAAATGTTATAAAATTGTATGAAGAGCATGGAAACACAGCCGTTTCGTGGTTAAGAACTCTCTTCCATGATTGCATGGTTAAGTCATGTGATGCATCAATTTTATTGGAGAGCATAAATGGGATCCAATCAGAAAAGAC...

CDS

Download CDS FASTA

966 bp · LXL04_004961|LXL04_004961|OH1004|CDS

ATGGCAATTCACAAACTACTTTGCATCTTTCTTTTTTTCCTTCATTTTTATTCTGGTCATAGTGAACTACAATTGAATTACTACTCACAAAGTTGTCCTAACGCTGAAGAAATAGTCAAAGAAAATGTTATAAAATTGTATGAAGAGCATGGAAACACAGCCGTTTCGTGGTTAAGAACTCTCTTCCATGATTGCATGGTTAAGTCATGTGATGCATCAATTTTATTGGAGAGCATAAATGGGATCCAATCAGAAAAGAC...

Protein

Download Protein FASTA

321 aa · LXL04_004961|LXL04_004961|OH1004|PROTEIN

MAIHKLLCIFLFFLHFYSGHSELQLNYYSQSCPNAEEIVKENVIKLYEEHGNTAVSWLRTLFHDCMVKSCDASILLESINGIQSEKTSKRNIGMRNFKYINTIKDALESSCPMTVSCADLVALSARDGIVMLGGPHVEMKTGRKDSMESHLAEIDSLLPNHNDSMLYVLDRFQSIGIDVEGTVALLGAHSVGRVHCMNLVDRLYPTVDPTLDPSFAEYLKHRCPHQNPDPRAVEYARSDLQTPMILDNMYYKNIKNNKGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004961`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004961

Location Chr01:151026604-151028918 (-)

Description Similar to PER21: Peroxidase 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37130`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At4g21960`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At4g08780`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At4g08770`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At5g17820`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0045926 negative regulation of growth Biological Process

GO:0048511 rhythmic process Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004601 peroxidase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37130

ath:AT4G08770

ath:AT4G08780

ath:AT4G21960

ath:AT5G17820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.447

Rank 1 · LXL04_004961 · OH-1004

Extracellular0.209

Rank 2 · LXL04_004961 · OH-1004

Cytoplasm0.145

Rank 3 · LXL04_004961 · OH-1004

Endoplasmic reticulum0.126

Rank 4 · LXL04_004961 · OH-1004

Cell membrane0.105

Rank 5 · LXL04_004961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141.29peroxidase39-283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004961	`PF00141.29`	peroxidase	39	283	8.8e-72	242.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42580`	Arabidopsis thaliana	Peroxidase 21	65.246%	Swiss-Prot	strong database homology
`Q9SB81`	Arabidopsis thaliana	Peroxidase 42	53.846%	Swiss-Prot	strong database homology
`Q9LDA4`	Arabidopsis thaliana	Peroxidase 38	37.419%	Swiss-Prot	moderate database homology
`Q9LDN9`	Arabidopsis thaliana	Peroxidase 37	37.419%	Swiss-Prot	moderate database homology
`Q43729`	Arabidopsis thaliana	Peroxidase 57	36.111%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card