LXL04_004818 | RubberDandelionOmics

Gene overview

LXL04_004818

Reference: OH-1004 Chr: Chr01 Coordinates: 147513556-147516452 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2442 bp · LXL04_004818|LXL04_004818|OH1004|cDNA

ATGAGAGCTGGTGGTTTCACTATCCAACAAGCTCTAAGTTCAGATGCGGCGACCATCATAAAACAGGCGGTAACCCTAGCACGCCGCCGCGGCCATGCTCAGGTGACCCCTTTACATGTGGCGAACACCATGCTCTCCTCCGCCACCGGCCTCCTCAGAACCGCCTGCTTGCAATCCCAATCCCACTCTCACCCTCTCCAGTGTAAAGCTCTCGAGCTTTGCTTCAACGTCGCTCTTAATCGCCTACCCACTTCCTCATC...

CDS

Download CDS FASTA

2442 bp · LXL04_004818|LXL04_004818|OH1004|CDS

ATGAGAGCTGGTGGTTTCACTATCCAACAAGCTCTAAGTTCAGATGCGGCGACCATCATAAAACAGGCGGTAACCCTAGCACGCCGCCGCGGCCATGCTCAGGTGACCCCTTTACATGTGGCGAACACCATGCTCTCCTCCGCCACCGGCCTCCTCAGAACCGCCTGCTTGCAATCCCAATCCCACTCTCACCCTCTCCAGTGTAAAGCTCTCGAGCTTTGCTTCAACGTCGCTCTTAATCGCCTACCCACTTCCTCATC...

Protein

Download Protein FASTA

813 aa · LXL04_004818|LXL04_004818|OH1004|PROTEIN

MRAGGFTIQQALSSDAATIIKQAVTLARRRGHAQVTPLHVANTMLSSATGLLRTACLQSQSHSHPLQCKALELCFNVALNRLPTSSSSPILGPNHSSQHPSISNALVAAFKRAQAHQRRGSIENQQQPLLAVKIELEQLIISILDDPSVSRVMREAGFSSTQVKSNVEQVVTLELSSQTPPPNSTSCNNNNNSIMSKNSSIDNYGNNEDVMYVIENLVNMKRSRSLVVVGECVATIESVVAKVMEKVDKGDVPEVIRDVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004818`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004818

Location Chr01:147513556-147516452 (+)

Description Similar to SMXL3: Protein SMAX1-LIKE 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52490`	May function in a transcriptional corepressor complex.	No verified direct reference in this release
`At4g29920`	May act as a transcriptional corepressor-complex component in salt tolerance through regulation of reactive oxygen species, stomatal closure, photosynthesis and K⁺/Na⁺ homeostasis.	Nuclear-localized AtHSPR links abscisic acid-dependent salt tolerance and antioxidant defense in Arabidopsis.2015 · DOI: 10.1111/tpj.13080
`At5g57710`	Probable component of a transcriptional corepressor complex that acts downstream of MAX2 to negatively regulate karrikins/strigolactone responses.	SUPPRESSOR OF MORE AXILLARY GROWTH2 1 controls seed germination and seedling development in Arabidopsis.2013 · DOI: 10.1104/pp.113.221259 SMAX1-LIKE/D53 Family Members Enable Distinct MAX2-Dependent Responses to Strigolactones and Karrikins in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00562 Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2
`At5g57130`	May function in a transcriptional corepressor complex.	No verified direct reference in this release
`At4g30350`	Probable component of a transcriptional corepressor complex that acts specifically in the karrikin pathway.	Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004818 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009845 seed germination Biological Process

GO:0010233 phloem transport Biological Process

GO:0033500 carbohydrate homeostasis Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0080167 response to karrikin Biological Process

GO:0090351 seedling development Biological Process

GO:1902347 response to strigolactone Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G52490

ath:AT4G29920

ath:AT4G30350

ath:AT5G57130

ath:AT5G57710

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.909

Rank 1 · LXL04_004818 · OH-1004

Cytoplasm0.132

Rank 2 · LXL04_004818 · OH-1004

Cell membrane0.037

Rank 3 · LXL04_004818 · OH-1004

Endoplasmic reticulum0.025

Rank 4 · LXL04_004818 · OH-1004

Plastid0.022

Rank 5 · LXL04_004818 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861.26Clp_N12-118 aa

PF23569.2NBD_SMAX1206-391 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004818	`PF02861.26`	Clp_N	12	118	7.9e-10	39.8
LXL04_004818	`PF23569.2`	NBD_SMAX1	206	391	1.4e-68	231.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVD0`	Arabidopsis thaliana	Protein SMAX1-LIKE 3	53.222%	Swiss-Prot	strong database homology
`Q9SZR3`	Arabidopsis thaliana	Protein SMAX1-LIKE 4	33.005%	Swiss-Prot	moderate database homology
`Q9FHH2`	Arabidopsis thaliana	Protein SUPPRESSOR OF MAX2 1	31.394%	Swiss-Prot	moderate database homology
`Q9LU73`	Arabidopsis thaliana	Protein SMAX1-LIKE 5	37.201%	Swiss-Prot	moderate database homology
`Q9M0C5`	Arabidopsis thaliana	Protein SMAX1-LIKE 2	34.071%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card