Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2208 bp · LXL04_004698|LXL04_004698|OH1004|cDNA
ATGGCGGTGCGTGCGACGGTGATACGGTTTCCGTCGGACCCGGACGCGCAGGATTTGTCGGGGGTGCCGTGGGGAGTGACGGTGACGCCGTTCGCCTCCAAGGACGAGAACGGTAACTCGCCTGTGTACGGATCGGGCGGAGACTTGATCCCTAGATGCGAGAATTGTTGGGGGTACTACAACACGTACTGTGATCAAGATCAGTGGGCGTGGACTTGCTCTCTCTGTGGAACCCTAAATGGCCTCACATCAGAAACAAT...
2208 bp · LXL04_004698|LXL04_004698|OH1004|CDS
ATGGCGGTGCGTGCGACGGTGATACGGTTTCCGTCGGACCCGGACGCGCAGGATTTGTCGGGGGTGCCGTGGGGAGTGACGGTGACGCCGTTCGCCTCCAAGGACGAGAACGGTAACTCGCCTGTGTACGGATCGGGCGGAGACTTGATCCCTAGATGCGAGAATTGTTGGGGGTACTACAACACGTACTGTGATCAAGATCAGTGGGCGTGGACTTGCTCTCTCTGTGGAACCCTAAATGGCCTCACATCAGAAACAAT...
Protein
Download Protein FASTA735 aa · LXL04_004698|LXL04_004698|OH1004|PROTEIN
MAVRATVIRFPSDPDAQDLSGVPWGVTVTPFASKDENGNSPVYGSGGDLIPRCENCWGYYNTYCDQDQWAWTCSLCGTLNGLTSETISRYSAPESAPENMSSFIDLEVPLEASDEQDMQARPVYVAAIDLASSEEFLELTKSALLAALEALAPGSLFGLATFSHKLGLYDVQGPIPVVKNVFLPADTDGTLPIDLEDAMPLFSFLAPVETCKDRIASALETLRPTSSWDSTGGGQGLDRILLGGRGFGLAMETLISYLGS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_004698 |
|---|---|
| TK1151 ID | TkA01G121480 |
| OH-1004 ID | LXL04_004698 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_004698 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:143832142-143836065 (-) | |||||||||
| Description | Similar to At3g07100: Protein transport protein Sec24-like At3g07100 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006886 intracellular protein transport Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007029 endoplasmic reticulum organization Biological Process GO:0007030 Golgi organization Biological Process GO:0008361 regulation of cell size Biological Process GO:0009555 pollen development Biological Process GO:0010584 pollen exine formation Biological Process GO:0032511 late endosome to vacuole transport via multivesicular body sorting pathway Biological Process GO:0032876 negative regulation of DNA endoreduplication Biological Process GO:0046740 transport of virus in host, cell to cell Biological Process GO:0048232 male gamete generation Biological Process GO:0048658 anther wall tapetum development Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G27460 ath:AT3G07100 hsa:10427 spo:2540710 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04810.21zf-Sec23_Sec2450-84 aaPF04811.22Sec23_trunk121-372 aaPF08033.18Sec23_BS378-450 aaPF04815.21Sec23_helical489-601 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_004698 | PF04810.21 | zf-Sec23_Sec24 | 50 | 84 | 6e-06 | 26.9 |
| LXL04_004698 | PF04811.22 | Sec23_trunk | 121 | 372 | 8.4e-24 | 85.2 |
| LXL04_004698 | PF08033.18 | Sec23_BS | 378 | 450 | 5e-06 | 27.7 |
| LXL04_004698 | PF04815.21 | Sec23_helical | 489 | 601 | 1.3e-15 | 57.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.