LXL04_004638 | RubberDandelionOmics

Gene overview

LXL04_004638

Reference: OH-1004 Chr: Chr01 Coordinates: 142135825-142137430 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · LXL04_004638|LXL04_004638|OH1004|cDNA

ATGTTGCGATGTTATCCGATTTCGGGCATGTTCCACCAAAAATCTACAGCAAGATGGAGCAAGAGTTTGTCTGTTTCCCTTCTCTCCCCAATTtcttctactactttccactCCCAATCAATCAAATCCAGCGTTCTTCCTACGAACCGGGACTCTCCTCTGACCGGTCTAGAGTCCGTTATGGTGGACTACATATTCGGGAAGAAGAAGGCCACAGAAGTTGCTCACTCTGTTTGGAAACACGTTATCCAAAAAGGGGA...

CDS

Download CDS FASTA

873 bp · LXL04_004638|LXL04_004638|OH1004|CDS

ATGTTGCGATGTTATCCGATTTCGGGCATGTTCCACCAAAAATCTACAGCAAGATGGAGCAAGAGTTTGTCTGTTTCCCTTCTCTCCCCAATTTCTTCTACTACTTTCCACTCCCAATCAATCAAATCCAGCGTTCTTCCTACGAACCGGGACTCTCCTCTGACCGGTCTAGAGTCCGTTATGGTGGACTACATATTCGGGAAGAAGAAGGCCACAGAAGTTGCTCACTCTGTTTGGAAACACGTTATCCAAAAAGGGGA...

Protein

Download Protein FASTA

290 aa · LXL04_004638|LXL04_004638|OH1004|PROTEIN

MLRCYPISGMFHQKSTARWSKSLSVSLLSPISSTTFHSQSIKSSVLPTNRDSPLTGLESVMVDYIFGKKKATEVAHSVWKHVIQKGDTVVDATCGNGHDTLAMVNMVSETDKSHGGHVYAMDIQETALKNTMSLLDASLHPNQKEIVKLFATCHSEIEQVVPKGATVRVVAFNLGYLPGGDKTVITKPETTLLGMMAASRVVISGGVISMLVYVGHPGGMDEYEKVETFACGLAVDAWICCKLQMLNRPLAPVLFLLCKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004638`
TK1151 ID	TkA01G129770
OH-1004 ID	LXL04_004638
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 89.655 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004638

Location Chr01:142135825-142137430 (+)

Description Similar to ytqB: Putative rRNA methylase YtqB (Bacillus subtilis (strain 168)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16445`	Involved in the biosynthesis of 5-methylaminomethyl-2-thiouridine (mnm(5)s(2)U) at the wobble position (U34) in tRNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0511700`	Involved in the biosynthesis of 5-methylaminomethyl-2-thiouridine (mnm(5)s(2)U) at the wobble position (U34) in tRNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004638 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008033 tRNA processing Biological Process

GO:0032259 methylation Biological Process

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004808 tRNA (5-methylaminomethyl-2-thiouridylate)(34)-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G16445

bsu:BSU30490

dosa:Os05g0511700

sao:SAOUHSC_01878

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.887

Rank 1 · LXL04_004638 · OH-1004

Cytoplasm0.095

Rank 2 · LXL04_004638 · OH-1004

Nucleus0.071

Rank 3 · LXL04_004638 · OH-1004

Plastid0.057

Rank 4 · LXL04_004638 · OH-1004

Cell membrane0.023

Rank 5 · LXL04_004638 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06962.19rRNA_methylase118-258 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004638	`PF06962.19`	rRNA_methylase	118	258	2e-38	132.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUP2`	Arabidopsis thaliana	tRNA (mnm(5)s(2)U34)-methyltransferase, chloroplastic	56.540%	Swiss-Prot	strong database homology
`Q0DGU2`	Oryza sativa subsp. japonica	tRNA (mnm(5)s(2)U34)-methyltransferase, chloroplastic	57.488%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card