LXL04_004610 | RubberDandelionOmics

Gene overview

LXL04_004610

Reference: OH-1004 Chr: Chr01 Coordinates: 141500202-141507032 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2832 bp · LXL04_004610|LXL04_004610|OH1004|cDNA

ATGTCTCCGAAGCCATCAGAGAACGGAACGGAAGGCGACGACGAGAGAGAAGAAGACGAGGAAGATACAGAAGAGGAcaaggaggaagaagaagaggaggaggaAGATGAGCCGAGGCTTAAGTACCAGCGAATGGGAGGCAACGTGCCTTCTCTTCTATCGAGTGACGCCGCTTCTTGTGTCGCGGTTGCCGAACGGATGATCGCTCTTGGTACTCATGGTGGTACCGTTCATATCCTGGATTTTCTTGGGAACCAGGT...

CDS

Download CDS FASTA

2832 bp · LXL04_004610|LXL04_004610|OH1004|CDS

ATGTCTCCGAAGCCATCAGAGAACGGAACGGAAGGCGACGACGAGAGAGAAGAAGACGAGGAAGATACAGAAGAGGACAAGGAGGAAGAAGAAGAGGAGGAGGAAGATGAGCCGAGGCTTAAGTACCAGCGAATGGGAGGCAACGTGCCTTCTCTTCTATCGAGTGACGCCGCTTCTTGTGTCGCGGTTGCCGAACGGATGATCGCTCTTGGTACTCATGGTGGTACCGTTCATATCCTGGATTTTCTTGGGAACCAGGT...

Protein

Download Protein FASTA

943 aa · LXL04_004610|LXL04_004610|OH1004|PROTEIN

MSPKPSENGTEGDDEREEDEEDTEEDKEEEEEEEEDEPRLKYQRMGGNVPSLLSSDAASCVAVAERMIALGTHGGTVHILDFLGNQVKEFRAHTAAVNDLCFDLDGEFIGSCSDDGSVVIISLFTDEKQKFEYHRPMKAIAIDPDYARKESRRFVTGGLAGNLYFNTKKWLGYRDQVLHSGEGPIHAVKWRTSLIAWANDAGVKVYDAANDQRVTFIERPRGSPRPELLLPHLVWQDDALLVIGWGTAIKIASIKTNQAR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004610`
TK1151 ID	TkA01G130660
OH-1004 ID	LXL04_004610
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004610

Location Chr01:141500202-141507032 (+)

Description Similar to VPS41: Vacuolar protein sorting-associated protein 41 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08190`	Required for vacuolar assembly and vacuolar traffic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004610 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0007034 vacuolar transport Biological Process

GO:0008333 endosome to lysosome transport Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009630 gravitropism Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0016236 macroautophagy Biological Process

GO:0034058 endosomal vesicle fusion Biological Process

GO:0035542 regulation of SNARE complex assembly Biological Process

GO:0045055 regulated exocytosis Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0061909 autophagosome-lysosome fusion Biological Process

KEGG gene cross-reference

ath:AT1G08190

dre:563215

hsa:27072

mmu:218035

sly:544040

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.486

Rank 1 · LXL04_004610 · OH-1004

Nucleus0.321

Rank 2 · LXL04_004610 · OH-1004

Lysosome / Vacuole0.164

Rank 3 · LXL04_004610 · OH-1004

Golgi apparatus0.152

Rank 4 · LXL04_004610 · OH-1004

Cell membrane0.130

Rank 5 · LXL04_004610 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23411.2Beta-prop_Vps4140-396 aa

PF24817.2WD40_WDHD1_1st59-127 aa

PF25173.2Beta-prop_WDR3_1st60-128 aa

PF25174.2Beta-prop_THOC364-145 aa

PF25175.2Beta-prop_WDR566-134 aa

PF00400.39WD4084-120 aa

PF24817.2WD40_WDHD1_1st92-215 aa

PF23556.2TPR_Vps41432-772 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004610	`PF23411.2`	Beta-prop_Vps41	40	396	3.8e-97	326.3
LXL04_004610	`PF24817.2`	WD40_WDHD1_1st	59	127	3.3e-09	37.1
LXL04_004610	`PF25173.2`	Beta-prop_WDR3_1st	60	128	5.9e-07	30.1
LXL04_004610	`PF25174.2`	Beta-prop_THOC3	64	145	6.2e-06	26.1
LXL04_004610	`PF25175.2`	Beta-prop_WDR5	66	134	6.6e-06	26.3
LXL04_004610	`PF00400.39`	WD40	84	120	6.3e-07	30.4
LXL04_004610	`PF24817.2`	WD40_WDHD1_1st	92	215	3.3e-09	37.1
LXL04_004610	`PF23556.2`	TPR_Vps41	432	772	4e-140	467.5
LXL04_004610	`PF28737.1`	VPS18_solenoid_2nd	579	738	1.3e-09	39.0
LXL04_004610	`PF00637.27`	Clathrin	617	750	1.8e-09	38.2
LXL04_004610	`PF23555.2`	zf-RING_Vps41	868	907	9.2e-10	38.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93043`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 41 homolog	72.679%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card