LXL04_004270 | RubberDandelionOmics

Gene overview

LXL04_004270

Reference: OH-1004 Chr: Chr01 Coordinates: 131572370-131578429 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1840 bp · LXL04_004270|LXL04_004270|OH1004|cDNA

ATGGAGGAGAAAGAATTTCGGAGCCGTCAATATGAAGGAGTCAAGAGGAAGAACGAGAAAtcaggaggaagaagaagtacGGGAAAGGAGGAGAAAAGGGGGAATCCGACGGAGATGGGAGCATTAATCCACAAGCTTCATTCCGAGAATGGAGGAAGCGACTGCAGTCACGAGCTGATTTCTAAGAACGAGGTCCTTTGGAAGTCATGGAGGCGGAGGAGAACCAGGAGCGAGAGTGGAGAGAAGGTCGTCAGATCTCA...

CDS

Download CDS FASTA

1815 bp · LXL04_004270|LXL04_004270|OH1004|CDS

ATGGAGGAGAAAGAATTTCGGAGCCGTCAATATGAAGGAGTCAAGAGGAAGAACGAGAAATCAGGAGGAAGAAGAAGTACGGGAAAGGAGGAGAAAAGGGGGAATCCGACGGAGATGGGAGCATTAATCCACAAGCTTCATTCCGAGAATGGAGGAAGCGACTGCAGTCACGAGCTGATTTCTAAGAACGAGGTCCTTTGGAAGTCATGGAGGCGGAGGAGAACCAGGAGCGAGAGTGGAGAGAAGGTCGTCAGATCTCA...

Protein

Download Protein FASTA

604 aa · LXL04_004270|LXL04_004270|OH1004|PROTEIN

MEEKEFRSRQYEGVKRKNEKSGGRRSTGKEEKRGNPTEMGALIHKLHSENGGSDCSHELISKNEVLWKSWRRRRTRSESGEKVVRSQKKASSAPDGVSTIPLYRSAPTLEVRLEDFERFAVDRLLGPVSTSLHSLFDNDEFIGINTFCYANFILRGISDALARGKKPDEMEKLVSDLWKTNMRHPHASEAIDKDIISHFVLRLVYCRTEELRKWFLSMESTLFRYRFRLETSDVHRALMTELGIPYKVVTNAEFEGLKEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004270`
TK1151 ID	TkA01G175690
OH-1004 ID	LXL04_004270
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.300
Protein coverage (%)	TK1151 97.122 / OH-1004 97.185 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004270

Location Chr01:131572370-131578429 (+)

Description Similar to At1g67320: Probable DNA primase large subunit

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67320`	DNA primase is the polymerase that synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004270 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006269 DNA replication, synthesis of primer Biological Process

GO:0006270 DNA replication initiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005658 alpha DNA polymerase:primase complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003899 DNA-directed RNA polymerase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G67320

hsa:5558

mmu:19076

rno:301323

spo:2539933

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.561

Rank 1 · LXL04_004270 · OH-1004

Cytoplasm0.260

Rank 2 · LXL04_004270 · OH-1004

Mitochondrion0.153

Rank 3 · LXL04_004270 · OH-1004

Cell membrane0.039

Rank 4 · LXL04_004270 · OH-1004

Peroxisome0.035

Rank 5 · LXL04_004270 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26466.1DNA_primase_lrg_N153-334 aa

PF04104.20DNA_primase_lrg376-544 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004270	`PF26466.1`	DNA_primase_lrg_N	153	334	5.2e-52	177.4
LXL04_004270	`PF04104.20`	DNA_primase_lrg	376	544	1.6e-65	220.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WJ2`	Arabidopsis thaliana	Probable DNA primase large subunit	65.474%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card