LXL04_004115 | RubberDandelionOmics

Gene overview

LXL04_004115

Reference: OH-1004 Chr: Chr01 Coordinates: 125717531-125724892 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1878 bp · LXL04_004115|LXL04_004115|OH1004|cDNA

ATGTTTGACGGTGCGTGCCCATGGCAGCCGCCTACCTTGAATTGCTTTCAAAAATTGGAAGGTTCCGTGAGAGTTATTCACGATTCCATCGGTCCACTGATAATTAAAGACCTTGCAAACGGTTTAAATCAGCAAAAGAAAAACATAGAGGAAATGTCAGGTGTGAGAAGAATCAAGCTCGGATCACAGGGGCTAGAGGTTTCAGCTATTGGACTAGGATGTATGGGCATGTCTCAAGGCTACGGACCTGCCAAGCCCGA...

CDS

Download CDS FASTA

1878 bp · LXL04_004115|LXL04_004115|OH1004|CDS

ATGTTTGACGGTGCGTGCCCATGGCAGCCGCCTACCTTGAATTGCTTTCAAAAATTGGAAGGTTCCGTGAGAGTTATTCACGATTCCATCGGTCCACTGATAATTAAAGACCTTGCAAACGGTTTAAATCAGCAAAAGAAAAACATAGAGGAAATGTCAGGTGTGAGAAGAATCAAGCTCGGATCACAGGGGCTAGAGGTTTCAGCTATTGGACTAGGATGTATGGGCATGTCTCAAGGCTACGGACCTGCCAAGCCCGA...

Protein

Download Protein FASTA

625 aa · LXL04_004115|LXL04_004115|OH1004|PROTEIN

MFDGACPWQPPTLNCFQKLEGSVRVIHDSIGPLIIKDLANGLNQQKKNIEEMSGVRRIKLGSQGLEVSAIGLGCMGMSQGYGPAKPEEEMIKVIHHAINSGVTHLDTSDVYGPHTNEILVGKALKGVKRSDVQLATKFGVKFGEGTGQAEVHGEPEYVRACCEASLKRLDVDYIDLYYVHRIDTSVPIEITMGELKKLVEEGKIKYIGLSEAGPATIRRAHAVHPITAVQLEWSLWTRDAEEEVISTCRELGIGIVPYSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004115`
TK1151 ID	TkA01G200450
OH-1004 ID	LXL04_004115
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 94.461 / OH-1004 51.840 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004115

Location Chr01:125717531-125724892 (-)

Description Similar to At1g60690: Probable aldo-keto reductase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60690`	Probable aldo-keto reductase 3.	No verified direct reference in this release
`At1g60710`	Probable aldo-keto reductase 4.	No verified direct reference in this release
`At1g60730`	Probable aldo-keto reductase 5.	No verified direct reference in this release
`At1g60680`	Probable aldo-keto reductase 2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0338000`	Probable aldo-keto reductase 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004115 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference

ath:AT1G60690

ath:AT1G60710

ath:AT1G60730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.721

Rank 1 · LXL04_004115 · OH-1004

Nucleus0.212

Rank 2 · LXL04_004115 · OH-1004

Peroxisome0.081

Rank 3 · LXL04_004115 · OH-1004

Mitochondrion0.074

Rank 4 · LXL04_004115 · OH-1004

Endoplasmic reticulum0.073

Rank 5 · LXL04_004115 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00248.28Aldo_ket_red70-363 aa

PF00248.28Aldo_ket_red376-595 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004115	`PF00248.28`	Aldo_ket_red	70	363	1.9e-130	434.9
LXL04_004115	`PF00248.28`	Aldo_ket_red	376	595	1.9e-130	434.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22707`	Arabidopsis thaliana	Probable aldo-keto reductase 3	71.077%	Swiss-Prot	moderate database homology
`Q93ZN2`	Arabidopsis thaliana	Probable aldo-keto reductase 4	71.473%	Swiss-Prot	moderate database homology
`Q9ASZ9`	Arabidopsis thaliana	Probable aldo-keto reductase 5	68.563%	Swiss-Prot	moderate database homology
`Q84M96`	Arabidopsis thaliana	Probable aldo-keto reductase 2	70.154%	Swiss-Prot	moderate database homology
`Q7XT99`	Oryza sativa subsp. japonica	Probable aldo-keto reductase 2	68.944%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card