LXL04_004100 | RubberDandelionOmics

Gene overview

LXL04_004100

Reference: OH-1004 Chr: Chr01 Coordinates: 125204057-125206221 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1530 bp · LXL04_004100|LXL04_004100|OH1004|cDNA

ATGGAAAAGGAGAAGTTTTACACCAATGAAAGGAATGGAATCCCCCAAGCCTGGAATTCCATCTTTGGAATGGGAATTGAAGGAAGTGAGCTGAATTGTAGCTCAGAACAACTTTCGAATTGCTTCTTTAACCCCAATTGCGAGAATTCAATTGACCAGAGAGATCTCTTTGAGTCTGCTTTGAGTTCAATTGTCTCTTCTCCAGCCAATTCCCACCCTGGAATCCCAATTCCAGGAGGTAGTAATGGTGGCGAAAGCAT...

CDS

Download CDS FASTA

1530 bp · LXL04_004100|LXL04_004100|OH1004|CDS

ATGGAAAAGGAGAAGTTTTACACCAATGAAAGGAATGGAATCCCCCAAGCCTGGAATTCCATCTTTGGAATGGGAATTGAAGGAAGTGAGCTGAATTGTAGCTCAGAACAACTTTCGAATTGCTTCTTTAACCCCAATTGCGAGAATTCAATTGACCAGAGAGATCTCTTTGAGTCTGCTTTGAGTTCAATTGTCTCTTCTCCAGCCAATTCCCACCCTGGAATCCCAATTCCAGGAGGTAGTAATGGTGGCGAAAGCAT...

Protein

Download Protein FASTA

509 aa · LXL04_004100|LXL04_004100|OH1004|PROTEIN

MEKEKFYTNERNGIPQAWNSIFGMGIEGSELNCSSEQLSNCFFNPNCENSIDQRDLFESALSSIVSSPANSHPGIPIPGGSNGGESIVLRELIGRLGSICNSGEISPQSGINGNNSTNNSYHNTPLNSPPKLNLSITDHQIQGSLPIPGNRQLPPAPFPTDPGFVERAARFSSFGAKNLMVKENESGTPSRSQFIGIAEENKKFSRLSMLSTQDNTERGDSREASSVSEQILSGETETETGMKGQSTSTNGRKRKVIPKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004100`
TK1151 ID	TkA01G203300
OH-1004 ID	LXL04_004100
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004100

Location Chr01:125204057-125206221 (-)

Description Similar to BHLH62: Transcription factor bHLH62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07340`	Transcription factor bHLH62.	No verified direct reference in this release
`At3g23690`	Transcription factor bHLH77.	No verified direct reference in this release
`At5g48560`	Transcription factor that binds DNA to G box 5'-CACGTG-3' and to E-box 5'-CANNTG-3' (By similarity).	Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861
`At1g68920`	Transcriptional activator involved in cell elongation.	No verified direct reference in this release
`At1g26260`	Transcriptional activator involved in cell elongation.	Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004100 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009637 response to blue light Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G26260

ath:AT1G68920

ath:AT3G07340

ath:AT3G23690

ath:AT5G48560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.972

Rank 1 · LXL04_004100 · OH-1004

Cytoplasm0.099

Rank 2 · LXL04_004100 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_004100 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_004100 · OH-1004

Plastid0.011

Rank 5 · LXL04_004100 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH334-381 aa

PF23173.3bHLH_SAC51339-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004100	`PF00010.32`	HLH	334	381	7.4e-07	29.6
LXL04_004100	`PF23173.3`	bHLH_SAC51	339	383	1.9e-06	28.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRT2`	Arabidopsis thaliana	Transcription factor bHLH62	41.215%	Swiss-Prot	moderate database homology
`Q9LK48`	Arabidopsis thaliana	Transcription factor bHLH77	50.943%	Swiss-Prot	moderate database homology
`Q9FJL4`	Arabidopsis thaliana	Transcription factor bHLH78	38.289%	Swiss-Prot	moderate database homology
`Q9CAA9`	Arabidopsis thaliana	Transcription factor bHLH49	38.298%	Swiss-Prot	moderate database homology
`Q9C670`	Arabidopsis thaliana	Transcription factor bHLH76	45.455%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card