LXL04_003767 | RubberDandelionOmics

Gene overview

LXL04_003767

Reference: OH-1004 Chr: Chr01 Coordinates: 100099337-100102224 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1314 bp · LXL04_003767|LXL04_003767|OH1004|cDNA

ATGGTGGCTTCAGCCGTAAAAGAAACACTCGGTGACCTAAATAAGGACTCCTTCGTCACCCTTCTCACCAAACTCATCGGAGAATCCAAATATGTTCAGAACAATCCGCCGGAGCTCATCCCGGAAGAAGATAGAATCGTCCGCCATGTTCGTGATTCCCTCCTCCCTCATAGCACCGCTACTGGCGGCGGCCCACTGATCATCAATCATGTCACGTATAAACCAAATAGAGGGAATCTCATAGTGGAGTACCCTGGAAC...

CDS

Download CDS FASTA

1314 bp · LXL04_003767|LXL04_003767|OH1004|CDS

ATGGTGGCTTCAGCCGTAAAAGAAACACTCGGTGACCTAAATAAGGACTCCTTCGTCACCCTTCTCACCAAACTCATCGGAGAATCCAAATATGTTCAGAACAATCCGCCGGAGCTCATCCCGGAAGAAGATAGAATCGTCCGCCATGTTCGTGATTCCCTCCTCCCTCATAGCACCGCTACTGGCGGCGGCCCACTGATCATCAATCATGTCACGTATAAACCAAATAGAGGGAATCTCATAGTGGAGTACCCTGGAAC...

Protein

Download Protein FASTA

437 aa · LXL04_003767|LXL04_003767|OH1004|PROTEIN

MVASAVKETLGDLNKDSFVTLLTKLIGESKYVQNNPPELIPEEDRIVRHVRDSLLPHSTATGGGPLIINHVTYKPNRGNLIVEYPGTEPGKILSFVGMHMDVVTANPSEWDFDPFSMSIDGDKLRGRGTTDCLGHVALVTELMKKLGQTKPKLKSSVVAVFIASEENSSIPGVGVDALVKDGLLDKLKNGPLFWIDTADKQPCIGTGGMIPWKLHVTGKLFHSGLAHKAINPFELAMEALKDIQTRFYKDFPPHAKEQVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003767`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003767

Location Chr01:100099337-100102224 (-)

Description Similar to At4g17830: Acetylornithine deacetylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17830`	Acetylornithine deacetylase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003767 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006526 L-arginine biosynthetic process Biological Process

GO:0006592 ornithine biosynthetic process Biological Process

GO:0006751 glutathione catabolic process Biological Process

GO:0009089 L-lysine biosynthetic process via diaminopimelate Biological Process

GO:0019877 diaminopimelate biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031012 extracellular matrix Cellular Component

GO:0045335 phagocytic vesicle Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0008777 acetylornithine deacetylase activity Molecular Function

GO:0009014 succinyl-diaminopimelate desuccinylase activity Molecular Function

KEGG gene cross-reference

ath:AT4G17830

ddi:DDB_G0267380

xcv:XCV1489

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.710

Rank 1 · LXL04_003767 · OH-1004

Nucleus0.346

Rank 2 · LXL04_003767 · OH-1004

Mitochondrion0.095

Rank 3 · LXL04_003767 · OH-1004

Endoplasmic reticulum0.081

Rank 4 · LXL04_003767 · OH-1004

Cell membrane0.076

Rank 5 · LXL04_003767 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01546.34Peptidase_M2096-433 aa

PF07687.20M20_dimer204-316 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003767	`PF01546.34`	Peptidase_M20	96	433	3.5e-21	76.8
LXL04_003767	`PF07687.20`	M20_dimer	204	316	1e-13	51.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5C4`	Arabidopsis thaliana	Acetylornithine deacetylase	80.645%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card