LXL04_003503 | RubberDandelionOmics

Gene overview

LXL04_003503

Reference: OH-1004 Chr: Chr01 Coordinates: 81512823-81522257 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1733 bp · LXL04_003503|LXL04_003503|OH1004|cDNA

ATGACGGTGGTGGCTGGGTTGAAGTCGTATGGAAGCGAAGCAGGAGAAAAGACGGAGGAAAGAGACGCCAAACGCTTTTGGCGCACATTGAGAGCAGAGTCTCTCATTTCACAATCCGGCGACTTCAATGCCGCCCTTTCATGCATCATTATCACTCACTTTCACTTGGATCATATTGGTGCTCTTCCGTACTTCACTGAAGTTTGTGGTTACACCGGTCCGATTTACATGACGTATCCAACCAAAGCCTTGGCTCCACT...

CDS

Download CDS FASTA

1509 bp · LXL04_003503|LXL04_003503|OH1004|CDS

ATGACGGTGGTGGCTGGGTTGAAGTCGTATGGAAGCGAAGCAGGAGAAAAGACGGAGGAAAGAGACGCCAAACGCTTTTGGCGCACATTGAGAGCAGAGTCTCTCATTTCACAATCCGGCGACTTCAATGCCGCCCTTTCATGCATCATTATCACTCACTTTCACTTGGATCATATTGGTGCTCTTCCGTACTTCACTGAAGTTTGTGGTTACACCGGTCCGATTTACATGACGTATCCAACCAAAGCCTTGGCTCCACT...

Protein

Download Protein FASTA

502 aa · LXL04_003503|LXL04_003503|OH1004|PROTEIN

MTVVAGLKSYGSEAGEKTEERDAKRFWRTLRAESLISQSGDFNAALSCIIITHFHLDHIGALPYFTEVCGYTGPIYMTYPTKALAPLMLEDYRKVMVGRGEEQQFTHENIVDCMKKVTAVDLKQNVQVDKDLQIRAYYAGHVLGAAMFYACVEGSGIVYTGDYNMTPDRHLGAAQIDRLQFDLLITESTYATTIRDSKYAREREFLKAVHKCVANGGKVLIPTFALGRAQELCILLDDYWERMNLKVPIYFSAGLTIQAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003503`
TK1151 ID	TkA01G349520
OH-1004 ID	LXL04_003503
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 61.155 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003503

Location Chr01:81512823-81522257 (-)

Description Similar to CPSF73-II: Cleavage and polyadenylation specificity factor subunit 3-II

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g01730`	Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition.	Unique features of plant cleavage and polyadenylation specificity factor revealed by proteomic studies.2009 · DOI: 10.1104/pp.109.142729

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003503 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0006397 mRNA processing Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0016180 snRNA processing Biological Process

GO:0034243 regulation of transcription elongation by RNA polymerase II Biological Process

GO:0034472 snRNA 3'-end processing Biological Process

GO:0160240 RNA polymerase II transcription initiation surveillance Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G01730

ddi:DDB_G0278189

hsa:54973

mmu:71957

rno:298688

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.632

Rank 1 · LXL04_003503 · OH-1004

Cytoplasm0.367

Rank 2 · LXL04_003503 · OH-1004

Mitochondrion0.070

Rank 3 · LXL04_003503 · OH-1004

Cell membrane0.040

Rank 4 · LXL04_003503 · OH-1004

Endoplasmic reticulum0.037

Rank 5 · LXL04_003503 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16661.12Lactamase_B_634-176 aa

PF00753.34Lactamase_B36-168 aa

PF23023.2Anti-Pycsar_Apyc145-169 aa

PF10996.15Beta-Casp229-347 aa

PF07521.18RMMBL363-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003503	`PF16661.12`	Lactamase_B_6	34	176	2.8e-18	66.7
LXL04_003503	`PF00753.34`	Lactamase_B	36	168	8.1e-08	33.1
LXL04_003503	`PF23023.2`	Anti-Pycsar_Apyc1	45	169	2.4e-06	28.2
LXL04_003503	`PF10996.15`	Beta-Casp	229	347	4.2e-27	95.8
LXL04_003503	`PF07521.18`	RMMBL	363	421	3.7e-17	62.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUU3`	Arabidopsis thaliana	Cleavage and polyadenylation specificity factor subunit 3-II	72.052%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card